Incidental Mutation 'R1781:Trip12'
ID195250
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Namethyroid hormone receptor interactor 12
Synonyms6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission 039812-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1781 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location84721189-84840516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84730621 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1739 (F1739I)
Ref Sequence ENSEMBL: ENSMUSP00000139563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000187733] [ENSMUST00000189670]
Predicted Effect probably benign
Transcript: ENSMUST00000027421
AA Change: F1772I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: F1772I

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185720
Predicted Effect probably benign
Transcript: ENSMUST00000186465
AA Change: F1772I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: F1772I

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186648
AA Change: F1739I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: F1739I

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187733
Predicted Effect probably benign
Transcript: ENSMUST00000189670
AA Change: F577I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219
AA Change: F577I

DomainStartEndE-ValueType
low complexity region 138 149 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
Blast:HECTc 168 222 5e-8 BLAST
Blast:HECTc 378 434 1e-24 BLAST
HECTc 441 830 6.2e-180 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191187
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 97% (88/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,380,495 R123W probably damaging Het
Aadacl2 A G 3: 60,024,696 K211E probably damaging Het
Abca13 T A 11: 9,269,194 L376Q probably damaging Het
Abca17 T C 17: 24,267,557 T1499A possibly damaging Het
Anks6 A C 4: 47,043,639 N363K possibly damaging Het
Apob T A 12: 8,009,603 I2695N possibly damaging Het
Atg14 T A 14: 47,549,150 probably null Het
Atg2a A T 19: 6,256,213 I1368F probably damaging Het
Btbd9 A G 17: 30,513,593 S373P probably damaging Het
Ccdc83 T C 7: 90,250,541 E41G probably damaging Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdh8 T C 8: 99,190,462 probably null Het
Cdh8 A T 8: 99,279,658 I99N probably damaging Het
Cdr2 G A 7: 120,958,045 P419L probably benign Het
Cds1 T A 5: 101,812,550 I289K possibly damaging Het
Cherp G A 8: 72,467,771 T394I probably damaging Het
Cyp4f17 T G 17: 32,524,019 I222S possibly damaging Het
Dcc A G 18: 71,378,717 S856P probably benign Het
Dcp1a C T 14: 30,513,075 T221I probably benign Het
Ddx10 A G 9: 53,207,545 S475P probably damaging Het
Dennd5b G T 6: 149,027,398 A759E probably damaging Het
Disp2 G A 2: 118,792,561 G1258D probably damaging Het
Fam208b T C 13: 3,584,759 T683A possibly damaging Het
Fhdc1 A T 3: 84,448,804 D444E probably damaging Het
Fhod1 T C 8: 105,347,789 probably benign Het
Gcnt7 T C 2: 172,454,880 K8R probably benign Het
Gk5 C T 9: 96,133,455 T108I possibly damaging Het
Gm8214 C A 1: 183,681,932 noncoding transcript Het
Gnl1 A T 17: 35,987,746 I434F probably damaging Het
Golga2 T C 2: 32,306,576 Y986H probably damaging Het
Gpr21 T C 2: 37,517,538 V32A probably benign Het
Grb14 A T 2: 64,975,555 probably null Het
H6pd A T 4: 149,995,931 F144L probably damaging Het
Hunk A G 16: 90,432,560 Y27C probably damaging Het
Ints7 C T 1: 191,596,284 T223M possibly damaging Het
Kcnmb2 T C 3: 32,179,003 probably null Het
Lilra6 A T 7: 3,915,067 L26H probably benign Het
Mc4r A T 18: 66,859,847 V65E probably damaging Het
Mgam G A 6: 40,669,863 G708R probably damaging Het
Mllt6 A G 11: 97,672,569 D326G probably benign Het
Myo7a A T 7: 98,073,124 V1198D probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Nlrp4b G C 7: 10,715,339 V123L probably benign Het
Ntpcr T A 8: 125,745,402 L150Q probably damaging Het
Obscn C T 11: 59,106,337 E1513K probably damaging Het
Ola1 T C 2: 73,156,755 K178E possibly damaging Het
Olfr1351 T C 10: 79,017,325 M1T probably null Het
Olfr1364 C T 13: 21,573,541 G305D probably damaging Het
Olfr1368 C T 13: 21,142,764 V98I probably benign Het
Olfr139 A T 11: 74,044,960 F105I probably damaging Het
Olfr486 A G 7: 108,171,883 V287A probably benign Het
Olfr53 A T 7: 140,652,506 I176F probably damaging Het
Olfr615 C T 7: 103,560,566 P30S probably benign Het
Olfr629 T C 7: 103,740,821 M140V probably benign Het
Olfr672 A T 7: 104,996,108 F265L possibly damaging Het
Olfr981 A G 9: 40,023,245 N284S probably damaging Het
Opalin T C 19: 41,067,631 probably null Het
P2ry12 A G 3: 59,217,778 F159L probably benign Het
Paqr7 T C 4: 134,507,281 probably null Het
Parp1 T C 1: 180,588,013 S466P probably benign Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh1 T C 18: 38,189,924 D952G probably damaging Het
Pde6c T C 19: 38,151,698 S336P possibly damaging Het
Pgk2 T C 17: 40,208,507 D10G probably benign Het
Phf20l1 A G 15: 66,632,825 T771A probably damaging Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Plekhm1 A G 11: 103,394,856 L251P probably damaging Het
Prex2 A T 1: 11,199,955 N1288I probably benign Het
Sarnp T C 10: 128,833,322 L16P probably damaging Het
Scgb3a2 T C 18: 43,766,968 probably benign Het
Scn11a A T 9: 119,755,082 I1489N probably damaging Het
Scn3a A T 2: 65,472,385 L1239Q probably damaging Het
Shisa9 T C 16: 12,267,657 S377P probably benign Het
Slc22a30 T A 19: 8,335,772 T550S probably damaging Het
Slc25a11 T C 11: 70,644,825 T296A probably benign Het
Slc35f1 T A 10: 53,062,436 probably null Het
Slc6a13 A G 6: 121,334,852 E396G probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srsf9 C A 5: 115,327,422 Y9* probably null Het
Tbx20 T C 9: 24,725,499 I431V probably benign Het
Tespa1 G A 10: 130,348,250 G67S probably benign Het
Trhde A T 10: 114,588,500 V460E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 G A 17: 30,968,550 R196H probably damaging Het
Vezf1 G T 11: 88,081,621 M269I probably benign Het
Vmn1r35 A T 6: 66,679,566 M40K probably benign Het
Vmn1r9 G T 6: 57,071,315 C125F probably benign Het
Vmn2r12 C A 5: 109,091,728 G323V probably benign Het
Vmn2r79 A T 7: 87,002,347 H318L probably benign Het
Zfhx3 T A 8: 108,793,535 S430T probably benign Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
Turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0627:Trip12 UTSW 1 84768597 missense probably damaging 1.00
R0630:Trip12 UTSW 1 84793915 missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0741:Trip12 UTSW 1 84745181 missense probably benign 0.09
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1847:Trip12 UTSW 1 84749269 missense probably damaging 1.00
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5510:Trip12 UTSW 1 84768680 missense probably damaging 1.00
R5542:Trip12 UTSW 1 84749344 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5914:Trip12 UTSW 1 84763458 missense probably damaging 1.00
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
R7355:Trip12 UTSW 1 84814883 missense probably damaging 1.00
R7361:Trip12 UTSW 1 84750442 missense probably damaging 0.98
R7588:Trip12 UTSW 1 84760883 missense probably damaging 0.99
R7705:Trip12 UTSW 1 84777449 missense probably damaging 1.00
R7818:Trip12 UTSW 1 84760806 missense probably damaging 1.00
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATGAGAAGGTATCCGCTTATGCCTA -3'
(R):5'- GCAGAAATTTGAGTCCCAGTTTGTGGT -3'

Sequencing Primer
(F):5'- agacacacatgcaggcac -3'
(R):5'- AGTCCCAGTTTGTGGTTCTTAATTTC -3'
Posted On2014-05-23