Incidental Mutation 'R1781:Anks6'
ID 195265
Institutional Source Beutler Lab
Gene Symbol Anks6
Ensembl Gene ENSMUSG00000066191
Gene Name ankyrin repeat and sterile alpha motif domain containing 6
Synonyms b2b1801.1Clo, LOC269533, 2210417J20Rik, SamCystin, Samd6
MMRRC Submission 039812-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1781 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 47015669-47057427 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 47043639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 363 (N363K)
Ref Sequence ENSEMBL: ENSMUSP00000155271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084616] [ENSMUST00000107747] [ENSMUST00000229609]
AlphaFold Q6GQX6
Predicted Effect unknown
Transcript: ENSMUST00000084616
AA Change: N363K
SMART Domains Protein: ENSMUSP00000081665
Gene: ENSMUSG00000066191
AA Change: N363K

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 539 575 N/A INTRINSIC
low complexity region 619 673 N/A INTRINSIC
SAM 700 766 2.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107747
AA Change: N363K

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103376
Gene: ENSMUSG00000066191
AA Change: N363K

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 607 643 N/A INTRINSIC
low complexity region 687 741 N/A INTRINSIC
low complexity region 748 768 N/A INTRINSIC
Blast:SAM 769 796 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154664
Predicted Effect possibly damaging
Transcript: ENSMUST00000229609
AA Change: N363K

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.4127 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 97% (88/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart defects including TGA, DORV and septal defects associated with heterotaxy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,380,495 R123W probably damaging Het
Aadacl2 A G 3: 60,024,696 K211E probably damaging Het
Abca13 T A 11: 9,269,194 L376Q probably damaging Het
Abca17 T C 17: 24,267,557 T1499A possibly damaging Het
Apob T A 12: 8,009,603 I2695N possibly damaging Het
Atg14 T A 14: 47,549,150 probably null Het
Atg2a A T 19: 6,256,213 I1368F probably damaging Het
Btbd9 A G 17: 30,513,593 S373P probably damaging Het
Ccdc83 T C 7: 90,250,541 E41G probably damaging Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdh8 T C 8: 99,190,462 probably null Het
Cdh8 A T 8: 99,279,658 I99N probably damaging Het
Cdr2 G A 7: 120,958,045 P419L probably benign Het
Cds1 T A 5: 101,812,550 I289K possibly damaging Het
Cherp G A 8: 72,467,771 T394I probably damaging Het
Cyp4f17 T G 17: 32,524,019 I222S possibly damaging Het
Dcc A G 18: 71,378,717 S856P probably benign Het
Dcp1a C T 14: 30,513,075 T221I probably benign Het
Ddx10 A G 9: 53,207,545 S475P probably damaging Het
Dennd5b G T 6: 149,027,398 A759E probably damaging Het
Disp2 G A 2: 118,792,561 G1258D probably damaging Het
Fam208b T C 13: 3,584,759 T683A possibly damaging Het
Fhdc1 A T 3: 84,448,804 D444E probably damaging Het
Fhod1 T C 8: 105,347,789 probably benign Het
Gcnt7 T C 2: 172,454,880 K8R probably benign Het
Gk5 C T 9: 96,133,455 T108I possibly damaging Het
Gm8214 C A 1: 183,681,932 noncoding transcript Het
Gnl1 A T 17: 35,987,746 I434F probably damaging Het
Golga2 T C 2: 32,306,576 Y986H probably damaging Het
Gpr21 T C 2: 37,517,538 V32A probably benign Het
Grb14 A T 2: 64,975,555 probably null Het
H6pd A T 4: 149,995,931 F144L probably damaging Het
Hunk A G 16: 90,432,560 Y27C probably damaging Het
Ints7 C T 1: 191,596,284 T223M possibly damaging Het
Kcnmb2 T C 3: 32,179,003 probably null Het
Lilra6 A T 7: 3,915,067 L26H probably benign Het
Mc4r A T 18: 66,859,847 V65E probably damaging Het
Mgam G A 6: 40,669,863 G708R probably damaging Het
Mllt6 A G 11: 97,672,569 D326G probably benign Het
Myo7a A T 7: 98,073,124 V1198D probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Nlrp4b G C 7: 10,715,339 V123L probably benign Het
Ntpcr T A 8: 125,745,402 L150Q probably damaging Het
Obscn C T 11: 59,106,337 E1513K probably damaging Het
Ola1 T C 2: 73,156,755 K178E possibly damaging Het
Olfr1351 T C 10: 79,017,325 M1T probably null Het
Olfr1364 C T 13: 21,573,541 G305D probably damaging Het
Olfr1368 C T 13: 21,142,764 V98I probably benign Het
Olfr139 A T 11: 74,044,960 F105I probably damaging Het
Olfr486 A G 7: 108,171,883 V287A probably benign Het
Olfr53 A T 7: 140,652,506 I176F probably damaging Het
Olfr615 C T 7: 103,560,566 P30S probably benign Het
Olfr629 T C 7: 103,740,821 M140V probably benign Het
Olfr672 A T 7: 104,996,108 F265L possibly damaging Het
Olfr981 A G 9: 40,023,245 N284S probably damaging Het
Opalin T C 19: 41,067,631 probably null Het
P2ry12 A G 3: 59,217,778 F159L probably benign Het
Paqr7 T C 4: 134,507,281 probably null Het
Parp1 T C 1: 180,588,013 S466P probably benign Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh1 T C 18: 38,189,924 D952G probably damaging Het
Pde6c T C 19: 38,151,698 S336P possibly damaging Het
Pgk2 T C 17: 40,208,507 D10G probably benign Het
Phf20l1 A G 15: 66,632,825 T771A probably damaging Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Plekhm1 A G 11: 103,394,856 L251P probably damaging Het
Prex2 A T 1: 11,199,955 N1288I probably benign Het
Sarnp T C 10: 128,833,322 L16P probably damaging Het
Scgb3a2 T C 18: 43,766,968 probably benign Het
Scn11a A T 9: 119,755,082 I1489N probably damaging Het
Scn3a A T 2: 65,472,385 L1239Q probably damaging Het
Shisa9 T C 16: 12,267,657 S377P probably benign Het
Slc22a30 T A 19: 8,335,772 T550S probably damaging Het
Slc25a11 T C 11: 70,644,825 T296A probably benign Het
Slc35f1 T A 10: 53,062,436 probably null Het
Slc6a13 A G 6: 121,334,852 E396G probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srsf9 C A 5: 115,327,422 Y9* probably null Het
Tbx20 T C 9: 24,725,499 I431V probably benign Het
Tespa1 G A 10: 130,348,250 G67S probably benign Het
Trhde A T 10: 114,588,500 V460E possibly damaging Het
Trip12 A T 1: 84,730,621 F1739I probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 G A 17: 30,968,550 R196H probably damaging Het
Vezf1 G T 11: 88,081,621 M269I probably benign Het
Vmn1r35 A T 6: 66,679,566 M40K probably benign Het
Vmn1r9 G T 6: 57,071,315 C125F probably benign Het
Vmn2r12 C A 5: 109,091,728 G323V probably benign Het
Vmn2r79 A T 7: 87,002,347 H318L probably benign Het
Zfhx3 T A 8: 108,793,535 S430T probably benign Het
Other mutations in Anks6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Anks6 APN 4 47046054 missense probably damaging 0.98
IGL01886:Anks6 APN 4 47044850 missense probably damaging 1.00
IGL02903:Anks6 APN 4 47045004 missense probably damaging 1.00
PIT4131001:Anks6 UTSW 4 47027109 missense probably damaging 1.00
R0632:Anks6 UTSW 4 47033167 missense possibly damaging 0.95
R1220:Anks6 UTSW 4 47025767 splice site probably benign
R1398:Anks6 UTSW 4 47044926 missense possibly damaging 0.75
R1479:Anks6 UTSW 4 47044874 missense probably damaging 1.00
R1519:Anks6 UTSW 4 47027152 missense probably damaging 0.99
R1713:Anks6 UTSW 4 47039726 missense probably benign 0.00
R1853:Anks6 UTSW 4 47049387 missense probably benign 0.00
R2364:Anks6 UTSW 4 47027248 missense possibly damaging 0.93
R3790:Anks6 UTSW 4 47049212 missense probably damaging 0.97
R4432:Anks6 UTSW 4 47044905 nonsense probably null
R4700:Anks6 UTSW 4 47033127 missense possibly damaging 0.86
R4847:Anks6 UTSW 4 47033266 missense probably benign
R4876:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4877:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4878:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4879:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4961:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4962:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4968:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4970:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4971:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5092:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5113:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5389:Anks6 UTSW 4 47038900 splice site probably benign
R5569:Anks6 UTSW 4 47045007 missense probably damaging 1.00
R5857:Anks6 UTSW 4 47039736 missense possibly damaging 0.92
R5977:Anks6 UTSW 4 47035748 missense probably benign 0.11
R5978:Anks6 UTSW 4 47049252 missense probably damaging 1.00
R6933:Anks6 UTSW 4 47049164 missense probably benign 0.25
R7175:Anks6 UTSW 4 47046268 splice site probably null
R7454:Anks6 UTSW 4 47038919 missense unknown
R7874:Anks6 UTSW 4 47049275 missense unknown
R8146:Anks6 UTSW 4 47043605 missense unknown
R8437:Anks6 UTSW 4 47030705 missense probably benign 0.00
R9454:Anks6 UTSW 4 47016789 missense possibly damaging 0.86
R9462:Anks6 UTSW 4 47033142 missense unknown
R9567:Anks6 UTSW 4 47044880 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCCCTTGATCCCTGAGACTGAC -3'
(R):5'- GGGAACATAGCCACACTTTCCCTG -3'

Sequencing Primer
(F):5'- CTTCATATAATGAATGGAGGCCGTG -3'
(R):5'- gtcactcctaacaaaatgccc -3'
Posted On 2014-05-23