Incidental Mutation 'R1781:Slc25a11'
ID195309
Institutional Source Beutler Lab
Gene Symbol Slc25a11
Ensembl Gene ENSMUSG00000014606
Gene Namesolute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11
Synonyms2310022P18Rik, 2oxoc
MMRRC Submission 039812-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R1781 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70644196-70647479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70644825 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 296 (T296A)
Ref Sequence ENSEMBL: ENSMUSP00000014750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014750] [ENSMUST00000037534] [ENSMUST00000055184] [ENSMUST00000108551] [ENSMUST00000136383] [ENSMUST00000139638] [ENSMUST00000141695] [ENSMUST00000152160]
Predicted Effect probably benign
Transcript: ENSMUST00000014750
AA Change: T296A

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000014750
Gene: ENSMUSG00000014606
AA Change: T296A

DomainStartEndE-ValueType
Pfam:Mito_carr 18 112 1.3e-22 PFAM
Pfam:Mito_carr 115 213 2.6e-19 PFAM
Pfam:Mito_carr 216 311 5.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037534
SMART Domains Protein: ENSMUSP00000036472
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PA 53 150 1.4e-14 PFAM
transmembrane domain 172 194 N/A INTRINSIC
RING 230 271 2.65e-9 SMART
low complexity region 278 303 N/A INTRINSIC
low complexity region 332 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055184
SMART Domains Protein: ENSMUSP00000057563
Gene: ENSMUSG00000050675

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108551
SMART Domains Protein: ENSMUSP00000104191
Gene: ENSMUSG00000050675

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134804
Predicted Effect probably benign
Transcript: ENSMUST00000136383
SMART Domains Protein: ENSMUSP00000120900
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 75 9.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139638
SMART Domains Protein: ENSMUSP00000114685
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 80 7.4e-17 PFAM
Pfam:Mito_carr 83 181 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141537
Predicted Effect probably benign
Transcript: ENSMUST00000141695
SMART Domains Protein: ENSMUSP00000121511
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151034
Predicted Effect probably benign
Transcript: ENSMUST00000152160
SMART Domains Protein: ENSMUSP00000115057
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157076
Meta Mutation Damage Score 0.2374 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 97% (88/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The oxoglutarate/malate carrier transports 2-oxoglutarate across the inner membranes of mitochondria in an electroneutral exchange for malate or other dicarboxylic acids (summary by Iacobazzi et al., 1992 [PubMed 1457818]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,380,495 R123W probably damaging Het
Aadacl2 A G 3: 60,024,696 K211E probably damaging Het
Abca13 T A 11: 9,269,194 L376Q probably damaging Het
Abca17 T C 17: 24,267,557 T1499A possibly damaging Het
Anks6 A C 4: 47,043,639 N363K possibly damaging Het
Apob T A 12: 8,009,603 I2695N possibly damaging Het
Atg14 T A 14: 47,549,150 probably null Het
Atg2a A T 19: 6,256,213 I1368F probably damaging Het
Btbd9 A G 17: 30,513,593 S373P probably damaging Het
Ccdc83 T C 7: 90,250,541 E41G probably damaging Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdh8 T C 8: 99,190,462 probably null Het
Cdh8 A T 8: 99,279,658 I99N probably damaging Het
Cdr2 G A 7: 120,958,045 P419L probably benign Het
Cds1 T A 5: 101,812,550 I289K possibly damaging Het
Cherp G A 8: 72,467,771 T394I probably damaging Het
Cyp4f17 T G 17: 32,524,019 I222S possibly damaging Het
Dcc A G 18: 71,378,717 S856P probably benign Het
Dcp1a C T 14: 30,513,075 T221I probably benign Het
Ddx10 A G 9: 53,207,545 S475P probably damaging Het
Dennd5b G T 6: 149,027,398 A759E probably damaging Het
Disp2 G A 2: 118,792,561 G1258D probably damaging Het
Fam208b T C 13: 3,584,759 T683A possibly damaging Het
Fhdc1 A T 3: 84,448,804 D444E probably damaging Het
Fhod1 T C 8: 105,347,789 probably benign Het
Gcnt7 T C 2: 172,454,880 K8R probably benign Het
Gk5 C T 9: 96,133,455 T108I possibly damaging Het
Gm8214 C A 1: 183,681,932 noncoding transcript Het
Gnl1 A T 17: 35,987,746 I434F probably damaging Het
Golga2 T C 2: 32,306,576 Y986H probably damaging Het
Gpr21 T C 2: 37,517,538 V32A probably benign Het
Grb14 A T 2: 64,975,555 probably null Het
H6pd A T 4: 149,995,931 F144L probably damaging Het
Hunk A G 16: 90,432,560 Y27C probably damaging Het
Ints7 C T 1: 191,596,284 T223M possibly damaging Het
Kcnmb2 T C 3: 32,179,003 probably null Het
Lilra6 A T 7: 3,915,067 L26H probably benign Het
Mc4r A T 18: 66,859,847 V65E probably damaging Het
Mgam G A 6: 40,669,863 G708R probably damaging Het
Mllt6 A G 11: 97,672,569 D326G probably benign Het
Myo7a A T 7: 98,073,124 V1198D probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Nlrp4b G C 7: 10,715,339 V123L probably benign Het
Ntpcr T A 8: 125,745,402 L150Q probably damaging Het
Obscn C T 11: 59,106,337 E1513K probably damaging Het
Ola1 T C 2: 73,156,755 K178E possibly damaging Het
Olfr1351 T C 10: 79,017,325 M1T probably null Het
Olfr1364 C T 13: 21,573,541 G305D probably damaging Het
Olfr1368 C T 13: 21,142,764 V98I probably benign Het
Olfr139 A T 11: 74,044,960 F105I probably damaging Het
Olfr486 A G 7: 108,171,883 V287A probably benign Het
Olfr53 A T 7: 140,652,506 I176F probably damaging Het
Olfr615 C T 7: 103,560,566 P30S probably benign Het
Olfr629 T C 7: 103,740,821 M140V probably benign Het
Olfr672 A T 7: 104,996,108 F265L possibly damaging Het
Olfr981 A G 9: 40,023,245 N284S probably damaging Het
Opalin T C 19: 41,067,631 probably null Het
P2ry12 A G 3: 59,217,778 F159L probably benign Het
Paqr7 T C 4: 134,507,281 probably null Het
Parp1 T C 1: 180,588,013 S466P probably benign Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh1 T C 18: 38,189,924 D952G probably damaging Het
Pde6c T C 19: 38,151,698 S336P possibly damaging Het
Pgk2 T C 17: 40,208,507 D10G probably benign Het
Phf20l1 A G 15: 66,632,825 T771A probably damaging Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Plekhm1 A G 11: 103,394,856 L251P probably damaging Het
Prex2 A T 1: 11,199,955 N1288I probably benign Het
Sarnp T C 10: 128,833,322 L16P probably damaging Het
Scgb3a2 T C 18: 43,766,968 probably benign Het
Scn11a A T 9: 119,755,082 I1489N probably damaging Het
Scn3a A T 2: 65,472,385 L1239Q probably damaging Het
Shisa9 T C 16: 12,267,657 S377P probably benign Het
Slc22a30 T A 19: 8,335,772 T550S probably damaging Het
Slc35f1 T A 10: 53,062,436 probably null Het
Slc6a13 A G 6: 121,334,852 E396G probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srsf9 C A 5: 115,327,422 Y9* probably null Het
Tbx20 T C 9: 24,725,499 I431V probably benign Het
Tespa1 G A 10: 130,348,250 G67S probably benign Het
Trhde A T 10: 114,588,500 V460E possibly damaging Het
Trip12 A T 1: 84,730,621 F1739I probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 G A 17: 30,968,550 R196H probably damaging Het
Vezf1 G T 11: 88,081,621 M269I probably benign Het
Vmn1r35 A T 6: 66,679,566 M40K probably benign Het
Vmn1r9 G T 6: 57,071,315 C125F probably benign Het
Vmn2r12 C A 5: 109,091,728 G323V probably benign Het
Vmn2r79 A T 7: 87,002,347 H318L probably benign Het
Zfhx3 T A 8: 108,793,535 S430T probably benign Het
Other mutations in Slc25a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03087:Slc25a11 APN 11 70645207 missense probably benign 0.09
IGL03348:Slc25a11 APN 11 70645344 unclassified probably benign
R0448:Slc25a11 UTSW 11 70645579 missense probably benign 0.43
R1368:Slc25a11 UTSW 11 70645526 splice site probably null
R1505:Slc25a11 UTSW 11 70646824 missense probably benign
R1970:Slc25a11 UTSW 11 70646173 missense probably benign 0.25
R2508:Slc25a11 UTSW 11 70645832 missense possibly damaging 0.95
R4397:Slc25a11 UTSW 11 70644851 missense probably benign 0.01
R4747:Slc25a11 UTSW 11 70645956 missense possibly damaging 0.95
R5177:Slc25a11 UTSW 11 70645817 missense probably damaging 1.00
R5243:Slc25a11 UTSW 11 70646098 missense probably damaging 1.00
R5296:Slc25a11 UTSW 11 70646185 missense probably damaging 0.97
R5510:Slc25a11 UTSW 11 70645535 missense probably damaging 1.00
R5662:Slc25a11 UTSW 11 70645419 nonsense probably null
R5771:Slc25a11 UTSW 11 70646190 missense probably damaging 0.97
R7287:Slc25a11 UTSW 11 70645355 missense probably benign
R7799:Slc25a11 UTSW 11 70645179 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCCCAGGGTAGCAGAATCCAG -3'
(R):5'- TGCGGATGATTGATGGGAAGCC -3'

Sequencing Primer
(F):5'- GTAGCAGAATCCAGGTCCTC -3'
(R):5'- TGATTGATGGGAAGCCAGAATAC -3'
Posted On2014-05-23