Incidental Mutation 'R1781:Fam208b'
ID195317
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Namefamily with sequence similarity 208, member B
SynonymsBC016423
MMRRC Submission 039812-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1781 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3566035-3611108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3584759 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 683 (T683A)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096069
AA Change: T683A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: T683A

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000222909
AA Change: T111A
Meta Mutation Damage Score 0.1087 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 97% (88/91)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,380,495 R123W probably damaging Het
Aadacl2 A G 3: 60,024,696 K211E probably damaging Het
Abca13 T A 11: 9,269,194 L376Q probably damaging Het
Abca17 T C 17: 24,267,557 T1499A possibly damaging Het
Anks6 A C 4: 47,043,639 N363K possibly damaging Het
Apob T A 12: 8,009,603 I2695N possibly damaging Het
Atg14 T A 14: 47,549,150 probably null Het
Atg2a A T 19: 6,256,213 I1368F probably damaging Het
Btbd9 A G 17: 30,513,593 S373P probably damaging Het
Ccdc83 T C 7: 90,250,541 E41G probably damaging Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdh8 T C 8: 99,190,462 probably null Het
Cdh8 A T 8: 99,279,658 I99N probably damaging Het
Cdr2 G A 7: 120,958,045 P419L probably benign Het
Cds1 T A 5: 101,812,550 I289K possibly damaging Het
Cherp G A 8: 72,467,771 T394I probably damaging Het
Cyp4f17 T G 17: 32,524,019 I222S possibly damaging Het
Dcc A G 18: 71,378,717 S856P probably benign Het
Dcp1a C T 14: 30,513,075 T221I probably benign Het
Ddx10 A G 9: 53,207,545 S475P probably damaging Het
Dennd5b G T 6: 149,027,398 A759E probably damaging Het
Disp2 G A 2: 118,792,561 G1258D probably damaging Het
Fhdc1 A T 3: 84,448,804 D444E probably damaging Het
Fhod1 T C 8: 105,347,789 probably benign Het
Gcnt7 T C 2: 172,454,880 K8R probably benign Het
Gk5 C T 9: 96,133,455 T108I possibly damaging Het
Gm8214 C A 1: 183,681,932 noncoding transcript Het
Gnl1 A T 17: 35,987,746 I434F probably damaging Het
Golga2 T C 2: 32,306,576 Y986H probably damaging Het
Gpr21 T C 2: 37,517,538 V32A probably benign Het
Grb14 A T 2: 64,975,555 probably null Het
H6pd A T 4: 149,995,931 F144L probably damaging Het
Hunk A G 16: 90,432,560 Y27C probably damaging Het
Ints7 C T 1: 191,596,284 T223M possibly damaging Het
Kcnmb2 T C 3: 32,179,003 probably null Het
Lilra6 A T 7: 3,915,067 L26H probably benign Het
Mc4r A T 18: 66,859,847 V65E probably damaging Het
Mgam G A 6: 40,669,863 G708R probably damaging Het
Mllt6 A G 11: 97,672,569 D326G probably benign Het
Myo7a A T 7: 98,073,124 V1198D probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Nlrp4b G C 7: 10,715,339 V123L probably benign Het
Ntpcr T A 8: 125,745,402 L150Q probably damaging Het
Obscn C T 11: 59,106,337 E1513K probably damaging Het
Ola1 T C 2: 73,156,755 K178E possibly damaging Het
Olfr1351 T C 10: 79,017,325 M1T probably null Het
Olfr1364 C T 13: 21,573,541 G305D probably damaging Het
Olfr1368 C T 13: 21,142,764 V98I probably benign Het
Olfr139 A T 11: 74,044,960 F105I probably damaging Het
Olfr486 A G 7: 108,171,883 V287A probably benign Het
Olfr53 A T 7: 140,652,506 I176F probably damaging Het
Olfr615 C T 7: 103,560,566 P30S probably benign Het
Olfr629 T C 7: 103,740,821 M140V probably benign Het
Olfr672 A T 7: 104,996,108 F265L possibly damaging Het
Olfr981 A G 9: 40,023,245 N284S probably damaging Het
Opalin T C 19: 41,067,631 probably null Het
P2ry12 A G 3: 59,217,778 F159L probably benign Het
Paqr7 T C 4: 134,507,281 probably null Het
Parp1 T C 1: 180,588,013 S466P probably benign Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh1 T C 18: 38,189,924 D952G probably damaging Het
Pde6c T C 19: 38,151,698 S336P possibly damaging Het
Pgk2 T C 17: 40,208,507 D10G probably benign Het
Phf20l1 A G 15: 66,632,825 T771A probably damaging Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Plekhm1 A G 11: 103,394,856 L251P probably damaging Het
Prex2 A T 1: 11,199,955 N1288I probably benign Het
Sarnp T C 10: 128,833,322 L16P probably damaging Het
Scgb3a2 T C 18: 43,766,968 probably benign Het
Scn11a A T 9: 119,755,082 I1489N probably damaging Het
Scn3a A T 2: 65,472,385 L1239Q probably damaging Het
Shisa9 T C 16: 12,267,657 S377P probably benign Het
Slc22a30 T A 19: 8,335,772 T550S probably damaging Het
Slc25a11 T C 11: 70,644,825 T296A probably benign Het
Slc35f1 T A 10: 53,062,436 probably null Het
Slc6a13 A G 6: 121,334,852 E396G probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srsf9 C A 5: 115,327,422 Y9* probably null Het
Tbx20 T C 9: 24,725,499 I431V probably benign Het
Tespa1 G A 10: 130,348,250 G67S probably benign Het
Trhde A T 10: 114,588,500 V460E possibly damaging Het
Trip12 A T 1: 84,730,621 F1739I probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 G A 17: 30,968,550 R196H probably damaging Het
Vezf1 G T 11: 88,081,621 M269I probably benign Het
Vmn1r35 A T 6: 66,679,566 M40K probably benign Het
Vmn1r9 G T 6: 57,071,315 C125F probably benign Het
Vmn2r12 C A 5: 109,091,728 G323V probably benign Het
Vmn2r79 A T 7: 87,002,347 H318L probably benign Het
Zfhx3 T A 8: 108,793,535 S430T probably benign Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3574832 missense probably benign
IGL00670:Fam208b APN 13 3585241 missense probably benign 0.14
IGL00957:Fam208b APN 13 3577101 missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3575885 missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3575067 missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3576633 missense probably benign 0.00
IGL02073:Fam208b APN 13 3574721 missense probably benign 0.01
IGL02152:Fam208b APN 13 3585371 missense probably benign
IGL02431:Fam208b APN 13 3574736 missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3574661 missense probably benign 0.12
IGL02732:Fam208b APN 13 3573626 missense probably benign 0.09
IGL02745:Fam208b APN 13 3585140 missense probably benign 0.23
IGL02800:Fam208b APN 13 3585154 missense probably benign
IGL02989:Fam208b APN 13 3584820 missense probably benign 0.01
IGL03124:Fam208b APN 13 3574704 missense probably benign 0.41
IGL03154:Fam208b APN 13 3575255 missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3574553 missense probably damaging 0.98
H8562:Fam208b UTSW 13 3577000 missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3574979 missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0157:Fam208b UTSW 13 3575550 missense probably benign 0.06
R0375:Fam208b UTSW 13 3596842 missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3582052 nonsense probably null
R0472:Fam208b UTSW 13 3588364 missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3566964 missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3590321 missense probably damaging 0.99
R0600:Fam208b UTSW 13 3576054 missense probably benign
R0659:Fam208b UTSW 13 3574448 missense probably damaging 0.99
R1257:Fam208b UTSW 13 3575049 missense probably benign 0.25
R1375:Fam208b UTSW 13 3576029 missense probably benign 0.06
R1443:Fam208b UTSW 13 3575543 missense probably benign 0.00
R1497:Fam208b UTSW 13 3570409 missense probably damaging 0.96
R1544:Fam208b UTSW 13 3590413 missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3576374 missense possibly damaging 0.85
R1629:Fam208b UTSW 13 3574121 missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3581771 missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3573860 missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3584498 critical splice donor site probably null
R1675:Fam208b UTSW 13 3569507 missense possibly damaging 0.65
R1792:Fam208b UTSW 13 3590559 missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3581759 missense probably damaging 0.98
R1920:Fam208b UTSW 13 3576612 missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3574853 missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2017:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2220:Fam208b UTSW 13 3581872 missense probably benign 0.00
R2513:Fam208b UTSW 13 3582150 missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3585122 missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3582185 missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3574359 missense probably damaging 0.98
R3623:Fam208b UTSW 13 3595556 missense probably benign
R3624:Fam208b UTSW 13 3595556 missense probably benign
R3725:Fam208b UTSW 13 3590538 missense probably benign 0.33
R3835:Fam208b UTSW 13 3575292 missense probably benign 0.01
R3890:Fam208b UTSW 13 3596785 missense probably damaging 0.96
R4023:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4024:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4025:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4050:Fam208b UTSW 13 3573507 missense probably benign 0.09
R4308:Fam208b UTSW 13 3569498 missense probably damaging 0.97
R4484:Fam208b UTSW 13 3581831 missense probably benign 0.12
R4674:Fam208b UTSW 13 3573686 missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3574495 missense probably benign 0.00
R4745:Fam208b UTSW 13 3590069 missense probably benign 0.26
R4776:Fam208b UTSW 13 3570391 missense probably damaging 1.00
R4839:Fam208b UTSW 13 3584807 missense probably damaging 0.96
R4855:Fam208b UTSW 13 3566680 splice site probably null
R5049:Fam208b UTSW 13 3574000 missense probably benign 0.00
R5076:Fam208b UTSW 13 3576357 missense probably benign 0.41
R5287:Fam208b UTSW 13 3575744 missense probably benign 0.41
R5298:Fam208b UTSW 13 3595613 splice site probably null
R5379:Fam208b UTSW 13 3588496 missense probably benign 0.41
R5512:Fam208b UTSW 13 3595517 missense probably damaging 0.99
R5624:Fam208b UTSW 13 3584996 missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3573642 nonsense probably null
R6114:Fam208b UTSW 13 3590081 missense probably damaging 1.00
R6118:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3576540 nonsense probably null
R6550:Fam208b UTSW 13 3590519 missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3594189 missense probably benign 0.00
R6797:Fam208b UTSW 13 3576769 missense probably benign 0.26
R6967:Fam208b UTSW 13 3574819 missense probably benign 0.22
R7016:Fam208b UTSW 13 3576857 missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3590521 missense probably damaging 0.99
R7454:Fam208b UTSW 13 3585332 missense probably benign 0.21
R7570:Fam208b UTSW 13 3573621 missense probably damaging 0.99
R7571:Fam208b UTSW 13 3575292 missense probably benign 0.01
R7580:Fam208b UTSW 13 3574752 missense probably damaging 0.99
R7587:Fam208b UTSW 13 3568849 missense possibly damaging 0.83
R7657:Fam208b UTSW 13 3573777 missense probably damaging 0.98
X0024:Fam208b UTSW 13 3599837 missense probably null 0.99
X0025:Fam208b UTSW 13 3576827 missense probably benign 0.15
X0066:Fam208b UTSW 13 3588441 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGGTCATCAACAGTGGCAAAACC -3'
(R):5'- CCGGGAATTGTCAGATGCAAGTCAG -3'

Sequencing Primer
(F):5'- AACAGTTTTCTCCAATGGGTTGC -3'
(R):5'- CAGATGCAAGTCAGAACTCTGTTG -3'
Posted On2014-05-23