Incidental Mutation 'R1781:Olfr1368'
ID195318
Institutional Source Beutler Lab
Gene Symbol Olfr1368
Ensembl Gene ENSMUSG00000045474
Gene Nameolfactory receptor 1368
SynonymsMOR256-15, GA_x6K02T2QHY8-12104556-12105500
MMRRC Submission 039812-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1781 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21141882-21145867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21142764 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 98 (V98I)
Ref Sequence ENSEMBL: ENSMUSP00000149549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055298] [ENSMUST00000216039]
Predicted Effect probably benign
Transcript: ENSMUST00000055298
AA Change: V98I

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000050942
Gene: ENSMUSG00000045474
AA Change: V98I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.8e-49 PFAM
Pfam:7tm_1 41 290 1.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206267
AA Change: V98I
Predicted Effect probably benign
Transcript: ENSMUST00000216039
AA Change: V98I

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 97% (88/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,380,495 R123W probably damaging Het
Aadacl2 A G 3: 60,024,696 K211E probably damaging Het
Abca13 T A 11: 9,269,194 L376Q probably damaging Het
Abca17 T C 17: 24,267,557 T1499A possibly damaging Het
Anks6 A C 4: 47,043,639 N363K possibly damaging Het
Apob T A 12: 8,009,603 I2695N possibly damaging Het
Atg14 T A 14: 47,549,150 probably null Het
Atg2a A T 19: 6,256,213 I1368F probably damaging Het
Btbd9 A G 17: 30,513,593 S373P probably damaging Het
Ccdc83 T C 7: 90,250,541 E41G probably damaging Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdh8 T C 8: 99,190,462 probably null Het
Cdh8 A T 8: 99,279,658 I99N probably damaging Het
Cdr2 G A 7: 120,958,045 P419L probably benign Het
Cds1 T A 5: 101,812,550 I289K possibly damaging Het
Cherp G A 8: 72,467,771 T394I probably damaging Het
Cyp4f17 T G 17: 32,524,019 I222S possibly damaging Het
Dcc A G 18: 71,378,717 S856P probably benign Het
Dcp1a C T 14: 30,513,075 T221I probably benign Het
Ddx10 A G 9: 53,207,545 S475P probably damaging Het
Dennd5b G T 6: 149,027,398 A759E probably damaging Het
Disp2 G A 2: 118,792,561 G1258D probably damaging Het
Fam208b T C 13: 3,584,759 T683A possibly damaging Het
Fhdc1 A T 3: 84,448,804 D444E probably damaging Het
Fhod1 T C 8: 105,347,789 probably benign Het
Gcnt7 T C 2: 172,454,880 K8R probably benign Het
Gk5 C T 9: 96,133,455 T108I possibly damaging Het
Gm8214 C A 1: 183,681,932 noncoding transcript Het
Gnl1 A T 17: 35,987,746 I434F probably damaging Het
Golga2 T C 2: 32,306,576 Y986H probably damaging Het
Gpr21 T C 2: 37,517,538 V32A probably benign Het
Grb14 A T 2: 64,975,555 probably null Het
H6pd A T 4: 149,995,931 F144L probably damaging Het
Hunk A G 16: 90,432,560 Y27C probably damaging Het
Ints7 C T 1: 191,596,284 T223M possibly damaging Het
Kcnmb2 T C 3: 32,179,003 probably null Het
Lilra6 A T 7: 3,915,067 L26H probably benign Het
Mc4r A T 18: 66,859,847 V65E probably damaging Het
Mgam G A 6: 40,669,863 G708R probably damaging Het
Mllt6 A G 11: 97,672,569 D326G probably benign Het
Myo7a A T 7: 98,073,124 V1198D probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Nlrp4b G C 7: 10,715,339 V123L probably benign Het
Ntpcr T A 8: 125,745,402 L150Q probably damaging Het
Obscn C T 11: 59,106,337 E1513K probably damaging Het
Ola1 T C 2: 73,156,755 K178E possibly damaging Het
Olfr1351 T C 10: 79,017,325 M1T probably null Het
Olfr1364 C T 13: 21,573,541 G305D probably damaging Het
Olfr139 A T 11: 74,044,960 F105I probably damaging Het
Olfr486 A G 7: 108,171,883 V287A probably benign Het
Olfr53 A T 7: 140,652,506 I176F probably damaging Het
Olfr615 C T 7: 103,560,566 P30S probably benign Het
Olfr629 T C 7: 103,740,821 M140V probably benign Het
Olfr672 A T 7: 104,996,108 F265L possibly damaging Het
Olfr981 A G 9: 40,023,245 N284S probably damaging Het
Opalin T C 19: 41,067,631 probably null Het
P2ry12 A G 3: 59,217,778 F159L probably benign Het
Paqr7 T C 4: 134,507,281 probably null Het
Parp1 T C 1: 180,588,013 S466P probably benign Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh1 T C 18: 38,189,924 D952G probably damaging Het
Pde6c T C 19: 38,151,698 S336P possibly damaging Het
Pgk2 T C 17: 40,208,507 D10G probably benign Het
Phf20l1 A G 15: 66,632,825 T771A probably damaging Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Plekhm1 A G 11: 103,394,856 L251P probably damaging Het
Prex2 A T 1: 11,199,955 N1288I probably benign Het
Sarnp T C 10: 128,833,322 L16P probably damaging Het
Scgb3a2 T C 18: 43,766,968 probably benign Het
Scn11a A T 9: 119,755,082 I1489N probably damaging Het
Scn3a A T 2: 65,472,385 L1239Q probably damaging Het
Shisa9 T C 16: 12,267,657 S377P probably benign Het
Slc22a30 T A 19: 8,335,772 T550S probably damaging Het
Slc25a11 T C 11: 70,644,825 T296A probably benign Het
Slc35f1 T A 10: 53,062,436 probably null Het
Slc6a13 A G 6: 121,334,852 E396G probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srsf9 C A 5: 115,327,422 Y9* probably null Het
Tbx20 T C 9: 24,725,499 I431V probably benign Het
Tespa1 G A 10: 130,348,250 G67S probably benign Het
Trhde A T 10: 114,588,500 V460E possibly damaging Het
Trip12 A T 1: 84,730,621 F1739I probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 G A 17: 30,968,550 R196H probably damaging Het
Vezf1 G T 11: 88,081,621 M269I probably benign Het
Vmn1r35 A T 6: 66,679,566 M40K probably benign Het
Vmn1r9 G T 6: 57,071,315 C125F probably benign Het
Vmn2r12 C A 5: 109,091,728 G323V probably benign Het
Vmn2r79 A T 7: 87,002,347 H318L probably benign Het
Zfhx3 T A 8: 108,793,535 S430T probably benign Het
Other mutations in Olfr1368
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03354:Olfr1368 APN 13 21142484 missense probably damaging 1.00
IGL03385:Olfr1368 APN 13 21142487 missense probably benign 0.01
R0137:Olfr1368 UTSW 13 21142166 missense possibly damaging 0.86
R1168:Olfr1368 UTSW 13 21142617 missense probably benign 0.04
R1212:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1214:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1237:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1238:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1239:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1280:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1309:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1436:Olfr1368 UTSW 13 21142992 missense probably benign 0.01
R1443:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1444:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1602:Olfr1368 UTSW 13 21142650 missense probably damaging 0.99
R1627:Olfr1368 UTSW 13 21142955 missense probably damaging 0.99
R1649:Olfr1368 UTSW 13 21142742 missense probably damaging 1.00
R1858:Olfr1368 UTSW 13 21142394 missense probably damaging 1.00
R2520:Olfr1368 UTSW 13 21142576 nonsense probably null
R4873:Olfr1368 UTSW 13 21142280 missense probably damaging 1.00
R4875:Olfr1368 UTSW 13 21142280 missense probably damaging 1.00
R5009:Olfr1368 UTSW 13 21142265 missense probably benign 0.01
R6222:Olfr1368 UTSW 13 21142877 missense probably damaging 1.00
R7031:Olfr1368 UTSW 13 21143000 missense probably benign
R7126:Olfr1368 UTSW 13 21142718 missense probably damaging 1.00
R7691:Olfr1368 UTSW 13 21142970 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAACAAAGAATTAACGCACTGCCG -3'
(R):5'- CCAACTGGAGCACATCATCTCTGC -3'

Sequencing Primer
(F):5'- TTAACGCACTGCCGAGACC -3'
(R):5'- TTGTGACTCTGGTAGGAAACAC -3'
Posted On2014-05-23