Incidental Mutation 'R1782:Wdr73'
ID 195387
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 2410008B13Rik, 1200011I23Rik
MMRRC Submission 039813-MU
Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock # R1782 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 80890723-80901269 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80891778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 339 (T339A)
Ref Sequence ENSEMBL: ENSMUSP00000026816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816]
AlphaFold Q9CWR1
Predicted Effect probably damaging
Transcript: ENSMUST00000026816
AA Change: T339A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: T339A

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139990
Predicted Effect probably benign
Transcript: ENSMUST00000146402
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152518
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,688 I47V probably benign Het
9330182L06Rik A T 5: 9,421,620 K320N possibly damaging Het
Abca13 A T 11: 9,297,971 T2573S probably benign Het
Adgra3 G T 5: 49,972,062 T738K probably benign Het
Adgrl4 C T 3: 151,542,805 Q705* probably null Het
Atp2b1 T G 10: 99,003,201 D630E probably benign Het
Atp2c1 G A 9: 105,431,587 R577C probably damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
C8g T A 2: 25,499,082 D163V possibly damaging Het
Catsper1 T C 19: 5,335,909 Y57H probably benign Het
Ccdc25 C T 14: 65,854,148 A72V probably benign Het
Cdca2 T G 14: 67,677,811 E666D probably benign Het
Cdh23 G A 10: 60,488,542 T313I probably damaging Het
Cfap57 C A 4: 118,614,975 R69L probably damaging Het
Chat C A 14: 32,408,987 V566L probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Cog1 A G 11: 113,653,966 T325A probably benign Het
Cxcl10 A G 5: 92,347,803 *94Q probably null Het
Cyp4a12b T C 4: 115,433,981 Y369H probably damaging Het
Dhx33 T C 11: 71,001,640 Y101C probably damaging Het
Dock6 A G 9: 21,811,846 M1593T probably damaging Het
Dpy19l3 T C 7: 35,708,155 T488A possibly damaging Het
Fam198b T C 3: 79,886,531 L102S possibly damaging Het
Fbxw14 A G 9: 109,278,691 I205T possibly damaging Het
Fbxw7 T C 3: 84,903,819 F84L probably benign Het
Flii T C 11: 60,714,636 T1212A probably benign Het
Fosl1 T A 19: 5,450,182 I43N probably damaging Het
Gabrr2 G A 4: 33,085,593 A338T probably damaging Het
Gatad2b T C 3: 90,341,871 V72A probably benign Het
Gorasp1 G T 9: 119,932,822 N48K probably damaging Het
Gramd1b C A 9: 40,413,337 D139Y probably damaging Het
Gtf3c1 A T 7: 125,667,074 V1030E probably damaging Het
H2afy A T 13: 56,074,321 M339K probably damaging Het
Havcr2 C T 11: 46,455,017 T6I unknown Het
Hgs A G 11: 120,478,505 E340G probably damaging Het
Irx2 A G 13: 72,631,466 T290A probably benign Het
Itgb8 T A 12: 119,192,118 I200F probably damaging Het
Josd2 A G 7: 44,471,153 I105V probably damaging Het
Kcnh7 T A 2: 62,736,169 D806V probably damaging Het
Kctd8 A G 5: 69,340,976 V109A possibly damaging Het
Kmt2d T A 15: 98,857,548 probably benign Het
Krtap2-4 A T 11: 99,614,527 V86E probably damaging Het
Lgr6 C G 1: 134,987,979 V344L probably damaging Het
Lime1 A T 2: 181,383,056 R168W possibly damaging Het
Magel2 C T 7: 62,380,857 Q1170* probably null Het
Ndufaf3 A T 9: 108,566,011 I169N probably damaging Het
Neb T A 2: 52,284,345 K1501* probably null Het
Nim1k A T 13: 119,712,151 S402R probably benign Het
Nt5dc2 T G 14: 31,138,201 S395R probably damaging Het
Oaz2 G T 9: 65,688,861 V132L probably benign Het
Olfr1089 T C 2: 86,732,682 K310R probably benign Het
Olfr1457 T A 19: 13,094,803 I282F probably damaging Het
Olfr315 T A 11: 58,778,805 L226H probably damaging Het
Olfr723 A T 14: 49,928,639 W302R probably benign Het
Olfr843 C T 9: 19,248,581 V273I probably benign Het
Pfkl A G 10: 77,988,720 V717A probably benign Het
Phgdh C T 3: 98,320,747 V231I probably damaging Het
Pkhd1 A T 1: 20,565,711 M465K probably damaging Het
Ppp3r1 A G 11: 17,198,281 H163R probably benign Het
Prune2 T A 19: 17,122,173 N1680K probably benign Het
Puf60 T A 15: 76,071,875 I216L probably benign Het
Rev3l T A 10: 39,799,885 N190K probably benign Het
Rp1 G A 1: 4,349,089 S600L probably benign Het
Rpl3l A G 17: 24,733,456 I217V probably benign Het
Scly T A 1: 91,308,380 V194D probably damaging Het
Scnn1b A G 7: 121,917,961 T607A probably benign Het
Slc13a3 G A 2: 165,445,519 L172F probably benign Het
Sorbs2 A G 8: 45,805,696 Y1090C probably damaging Het
Spag17 T A 3: 100,010,754 M351K probably benign Het
St14 A G 9: 31,100,164 Y444H probably damaging Het
Taf8 C A 17: 47,498,211 A109S probably benign Het
Tbc1d30 T A 10: 121,267,620 K502N probably damaging Het
Them5 T C 3: 94,344,489 S136P probably benign Het
Tmem248 T A 5: 130,231,928 N111K probably damaging Het
Tmem74 C A 15: 43,866,952 V232L probably damaging Het
Tnip2 A T 5: 34,499,668 H264Q probably benign Het
Trim5 A G 7: 104,265,816 probably null Het
Trim63 A G 4: 134,323,038 Q211R probably benign Het
Trrap T C 5: 144,822,703 V2231A possibly damaging Het
Ttn T C 2: 76,735,487 S28174G probably benign Het
Ugt2b36 T C 5: 87,081,581 D341G possibly damaging Het
Uroc1 G A 6: 90,336,919 E63K probably damaging Het
Ush2a T C 1: 188,911,185 V4248A probably benign Het
Usp1 A G 4: 98,934,198 H583R probably damaging Het
Usp8 T A 2: 126,720,051 F55Y probably damaging Het
Vmn2r13 T A 5: 109,158,174 T513S probably benign Het
Wnt2 T A 6: 18,008,640 N266I possibly damaging Het
Wwp2 AGAACT A 8: 107,506,399 probably null Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80897950 nonsense probably null
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80897950 nonsense probably null
R1349:Wdr73 UTSW 7 80893252 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R3085:Wdr73 UTSW 7 80901242 unclassified probably benign
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4480:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5046:Wdr73 UTSW 7 80892425 unclassified probably benign
R5286:Wdr73 UTSW 7 80891809 missense probably benign 0.04
R5842:Wdr73 UTSW 7 80891710 missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
R7362:Wdr73 UTSW 7 80900703 missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80893227 missense probably benign 0.13
R8558:Wdr73 UTSW 7 80898506 missense probably damaging 1.00
R8950:Wdr73 UTSW 7 80900383 missense probably benign 0.00
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GGAACACAGCCTGCTGCTATACAC -3'
(R):5'- TAGGGTCACACCTCTCTTTGCACG -3'

Sequencing Primer
(F):5'- caggtaagaaaaagggacaagaag -3'
(R):5'- TGCACGTTCTTCTCCAGG -3'
Posted On 2014-05-23