Incidental Mutation 'R1782:Olfr1457'
ID195441
Institutional Source Beutler Lab
Gene Symbol Olfr1457
Ensembl Gene ENSMUSG00000061637
Gene Nameolfactory receptor 1457
SynonymsGA_x6K02T2RE5P-3423041-3422097, MOR202-20
MMRRC Submission 039813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1782 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13093379-13097891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13094803 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 282 (I282F)
Ref Sequence ENSEMBL: ENSMUSP00000150957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075170] [ENSMUST00000208913] [ENSMUST00000214561] [ENSMUST00000215229]
Predicted Effect probably damaging
Transcript: ENSMUST00000075170
AA Change: I282F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074665
Gene: ENSMUSG00000061637
AA Change: I282F

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.6e-45 PFAM
Pfam:7tm_1 42 291 9.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208913
Predicted Effect probably damaging
Transcript: ENSMUST00000214561
AA Change: I109F

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215229
AA Change: I282F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,688 I47V probably benign Het
9330182L06Rik A T 5: 9,421,620 K320N possibly damaging Het
Abca13 A T 11: 9,297,971 T2573S probably benign Het
Adgra3 G T 5: 49,972,062 T738K probably benign Het
Adgrl4 C T 3: 151,542,805 Q705* probably null Het
Atp2b1 T G 10: 99,003,201 D630E probably benign Het
Atp2c1 G A 9: 105,431,587 R577C probably damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
C8g T A 2: 25,499,082 D163V possibly damaging Het
Catsper1 T C 19: 5,335,909 Y57H probably benign Het
Ccdc25 C T 14: 65,854,148 A72V probably benign Het
Cdca2 T G 14: 67,677,811 E666D probably benign Het
Cdh23 G A 10: 60,488,542 T313I probably damaging Het
Cfap57 C A 4: 118,614,975 R69L probably damaging Het
Chat C A 14: 32,408,987 V566L probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Cog1 A G 11: 113,653,966 T325A probably benign Het
Cxcl10 A G 5: 92,347,803 *94Q probably null Het
Cyp4a12b T C 4: 115,433,981 Y369H probably damaging Het
Dhx33 T C 11: 71,001,640 Y101C probably damaging Het
Dock6 A G 9: 21,811,846 M1593T probably damaging Het
Dpy19l3 T C 7: 35,708,155 T488A possibly damaging Het
Fam198b T C 3: 79,886,531 L102S possibly damaging Het
Fbxw14 A G 9: 109,278,691 I205T possibly damaging Het
Fbxw7 T C 3: 84,903,819 F84L probably benign Het
Flii T C 11: 60,714,636 T1212A probably benign Het
Fosl1 T A 19: 5,450,182 I43N probably damaging Het
Gabrr2 G A 4: 33,085,593 A338T probably damaging Het
Gatad2b T C 3: 90,341,871 V72A probably benign Het
Gorasp1 G T 9: 119,932,822 N48K probably damaging Het
Gramd1b C A 9: 40,413,337 D139Y probably damaging Het
Gtf3c1 A T 7: 125,667,074 V1030E probably damaging Het
H2afy A T 13: 56,074,321 M339K probably damaging Het
Havcr2 C T 11: 46,455,017 T6I unknown Het
Hgs A G 11: 120,478,505 E340G probably damaging Het
Irx2 A G 13: 72,631,466 T290A probably benign Het
Itgb8 T A 12: 119,192,118 I200F probably damaging Het
Josd2 A G 7: 44,471,153 I105V probably damaging Het
Kcnh7 T A 2: 62,736,169 D806V probably damaging Het
Kctd8 A G 5: 69,340,976 V109A possibly damaging Het
Kmt2d T A 15: 98,857,548 probably benign Het
Krtap2-4 A T 11: 99,614,527 V86E probably damaging Het
Lgr6 C G 1: 134,987,979 V344L probably damaging Het
Lime1 A T 2: 181,383,056 R168W possibly damaging Het
Magel2 C T 7: 62,380,857 Q1170* probably null Het
Ndufaf3 A T 9: 108,566,011 I169N probably damaging Het
Neb T A 2: 52,284,345 K1501* probably null Het
Nim1k A T 13: 119,712,151 S402R probably benign Het
Nt5dc2 T G 14: 31,138,201 S395R probably damaging Het
Oaz2 G T 9: 65,688,861 V132L probably benign Het
Olfr1089 T C 2: 86,732,682 K310R probably benign Het
Olfr315 T A 11: 58,778,805 L226H probably damaging Het
Olfr723 A T 14: 49,928,639 W302R probably benign Het
Olfr843 C T 9: 19,248,581 V273I probably benign Het
Pfkl A G 10: 77,988,720 V717A probably benign Het
Phgdh C T 3: 98,320,747 V231I probably damaging Het
Pkhd1 A T 1: 20,565,711 M465K probably damaging Het
Ppp3r1 A G 11: 17,198,281 H163R probably benign Het
Prune2 T A 19: 17,122,173 N1680K probably benign Het
Puf60 T A 15: 76,071,875 I216L probably benign Het
Rev3l T A 10: 39,799,885 N190K probably benign Het
Rp1 G A 1: 4,349,089 S600L probably benign Het
Rpl3l A G 17: 24,733,456 I217V probably benign Het
Scly T A 1: 91,308,380 V194D probably damaging Het
Scnn1b A G 7: 121,917,961 T607A probably benign Het
Slc13a3 G A 2: 165,445,519 L172F probably benign Het
Sorbs2 A G 8: 45,805,696 Y1090C probably damaging Het
Spag17 T A 3: 100,010,754 M351K probably benign Het
St14 A G 9: 31,100,164 Y444H probably damaging Het
Taf8 C A 17: 47,498,211 A109S probably benign Het
Tbc1d30 T A 10: 121,267,620 K502N probably damaging Het
Them5 T C 3: 94,344,489 S136P probably benign Het
Tmem248 T A 5: 130,231,928 N111K probably damaging Het
Tmem74 C A 15: 43,866,952 V232L probably damaging Het
Tnip2 A T 5: 34,499,668 H264Q probably benign Het
Trim5 A G 7: 104,265,816 probably null Het
Trim63 A G 4: 134,323,038 Q211R probably benign Het
Trrap T C 5: 144,822,703 V2231A possibly damaging Het
Ttn T C 2: 76,735,487 S28174G probably benign Het
Ugt2b36 T C 5: 87,081,581 D341G possibly damaging Het
Uroc1 G A 6: 90,336,919 E63K probably damaging Het
Ush2a T C 1: 188,911,185 V4248A probably benign Het
Usp1 A G 4: 98,934,198 H583R probably damaging Het
Usp8 T A 2: 126,720,051 F55Y probably damaging Het
Vmn2r13 T A 5: 109,158,174 T513S probably benign Het
Wdr73 T C 7: 80,891,778 T339A probably damaging Het
Wnt2 T A 6: 18,008,640 N266I possibly damaging Het
Wwp2 AGAACT A 8: 107,506,399 probably null Het
Other mutations in Olfr1457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr1457 APN 19 13095112 missense probably damaging 1.00
IGL01815:Olfr1457 APN 19 13095656 splice site probably null
IGL02033:Olfr1457 APN 19 13094857 missense possibly damaging 0.54
R0490:Olfr1457 UTSW 19 13094812 missense probably damaging 1.00
R1205:Olfr1457 UTSW 19 13095535 missense probably benign 0.01
R1299:Olfr1457 UTSW 19 13095130 missense possibly damaging 0.78
R1983:Olfr1457 UTSW 19 13095384 missense probably benign 0.01
R2364:Olfr1457 UTSW 19 13094754 missense probably damaging 1.00
R3815:Olfr1457 UTSW 19 13094913 missense probably damaging 0.98
R4092:Olfr1457 UTSW 19 13095426 missense probably damaging 0.97
R4430:Olfr1457 UTSW 19 13095088 missense probably benign 0.03
R7200:Olfr1457 UTSW 19 13095232 missense probably benign 0.04
R8079:Olfr1457 UTSW 19 13095284 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCACTGGGGTATTGTCATGAAGGC -3'
(R):5'- CACTCAAGTGCTGGATATGGGAAGG -3'

Sequencing Primer
(F):5'- GCCaaaacaaagaaacaaaacaaaac -3'
(R):5'- AAGGCTGCACCCACTTG -3'
Posted On2014-05-23