Incidental Mutation 'R1782:Prune2'
ID195442
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Nameprune homolog 2
SynonymsA230083H22Rik, 6330414G02Rik, A330102H22Rik
MMRRC Submission 039813-MU
Accession Numbers

Genbank: NM_181348

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1782 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location16956118-17223932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17122173 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1680 (N1680K)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
Predicted Effect probably benign
Transcript: ENSMUST00000087689
AA Change: N1680K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: N1680K

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226052
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,688 I47V probably benign Het
9330182L06Rik A T 5: 9,421,620 K320N possibly damaging Het
Abca13 A T 11: 9,297,971 T2573S probably benign Het
Adgra3 G T 5: 49,972,062 T738K probably benign Het
Adgrl4 C T 3: 151,542,805 Q705* probably null Het
Atp2b1 T G 10: 99,003,201 D630E probably benign Het
Atp2c1 G A 9: 105,431,587 R577C probably damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
C8g T A 2: 25,499,082 D163V possibly damaging Het
Catsper1 T C 19: 5,335,909 Y57H probably benign Het
Ccdc25 C T 14: 65,854,148 A72V probably benign Het
Cdca2 T G 14: 67,677,811 E666D probably benign Het
Cdh23 G A 10: 60,488,542 T313I probably damaging Het
Cfap57 C A 4: 118,614,975 R69L probably damaging Het
Chat C A 14: 32,408,987 V566L probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Cog1 A G 11: 113,653,966 T325A probably benign Het
Cxcl10 A G 5: 92,347,803 *94Q probably null Het
Cyp4a12b T C 4: 115,433,981 Y369H probably damaging Het
Dhx33 T C 11: 71,001,640 Y101C probably damaging Het
Dock6 A G 9: 21,811,846 M1593T probably damaging Het
Dpy19l3 T C 7: 35,708,155 T488A possibly damaging Het
Fam198b T C 3: 79,886,531 L102S possibly damaging Het
Fbxw14 A G 9: 109,278,691 I205T possibly damaging Het
Fbxw7 T C 3: 84,903,819 F84L probably benign Het
Flii T C 11: 60,714,636 T1212A probably benign Het
Fosl1 T A 19: 5,450,182 I43N probably damaging Het
Gabrr2 G A 4: 33,085,593 A338T probably damaging Het
Gatad2b T C 3: 90,341,871 V72A probably benign Het
Gorasp1 G T 9: 119,932,822 N48K probably damaging Het
Gramd1b C A 9: 40,413,337 D139Y probably damaging Het
Gtf3c1 A T 7: 125,667,074 V1030E probably damaging Het
H2afy A T 13: 56,074,321 M339K probably damaging Het
Havcr2 C T 11: 46,455,017 T6I unknown Het
Hgs A G 11: 120,478,505 E340G probably damaging Het
Irx2 A G 13: 72,631,466 T290A probably benign Het
Itgb8 T A 12: 119,192,118 I200F probably damaging Het
Josd2 A G 7: 44,471,153 I105V probably damaging Het
Kcnh7 T A 2: 62,736,169 D806V probably damaging Het
Kctd8 A G 5: 69,340,976 V109A possibly damaging Het
Kmt2d T A 15: 98,857,548 probably benign Het
Krtap2-4 A T 11: 99,614,527 V86E probably damaging Het
Lgr6 C G 1: 134,987,979 V344L probably damaging Het
Lime1 A T 2: 181,383,056 R168W possibly damaging Het
Magel2 C T 7: 62,380,857 Q1170* probably null Het
Ndufaf3 A T 9: 108,566,011 I169N probably damaging Het
Neb T A 2: 52,284,345 K1501* probably null Het
Nim1k A T 13: 119,712,151 S402R probably benign Het
Nt5dc2 T G 14: 31,138,201 S395R probably damaging Het
Oaz2 G T 9: 65,688,861 V132L probably benign Het
Olfr1089 T C 2: 86,732,682 K310R probably benign Het
Olfr1457 T A 19: 13,094,803 I282F probably damaging Het
Olfr315 T A 11: 58,778,805 L226H probably damaging Het
Olfr723 A T 14: 49,928,639 W302R probably benign Het
Olfr843 C T 9: 19,248,581 V273I probably benign Het
Pfkl A G 10: 77,988,720 V717A probably benign Het
Phgdh C T 3: 98,320,747 V231I probably damaging Het
Pkhd1 A T 1: 20,565,711 M465K probably damaging Het
Ppp3r1 A G 11: 17,198,281 H163R probably benign Het
Puf60 T A 15: 76,071,875 I216L probably benign Het
Rev3l T A 10: 39,799,885 N190K probably benign Het
Rp1 G A 1: 4,349,089 S600L probably benign Het
Rpl3l A G 17: 24,733,456 I217V probably benign Het
Scly T A 1: 91,308,380 V194D probably damaging Het
Scnn1b A G 7: 121,917,961 T607A probably benign Het
Slc13a3 G A 2: 165,445,519 L172F probably benign Het
Sorbs2 A G 8: 45,805,696 Y1090C probably damaging Het
Spag17 T A 3: 100,010,754 M351K probably benign Het
St14 A G 9: 31,100,164 Y444H probably damaging Het
Taf8 C A 17: 47,498,211 A109S probably benign Het
Tbc1d30 T A 10: 121,267,620 K502N probably damaging Het
Them5 T C 3: 94,344,489 S136P probably benign Het
Tmem248 T A 5: 130,231,928 N111K probably damaging Het
Tmem74 C A 15: 43,866,952 V232L probably damaging Het
Tnip2 A T 5: 34,499,668 H264Q probably benign Het
Trim5 A G 7: 104,265,816 probably null Het
Trim63 A G 4: 134,323,038 Q211R probably benign Het
Trrap T C 5: 144,822,703 V2231A possibly damaging Het
Ttn T C 2: 76,735,487 S28174G probably benign Het
Ugt2b36 T C 5: 87,081,581 D341G possibly damaging Het
Uroc1 G A 6: 90,336,919 E63K probably damaging Het
Ush2a T C 1: 188,911,185 V4248A probably benign Het
Usp1 A G 4: 98,934,198 H583R probably damaging Het
Usp8 T A 2: 126,720,051 F55Y probably damaging Het
Vmn2r13 T A 5: 109,158,174 T513S probably benign Het
Wdr73 T C 7: 80,891,778 T339A probably damaging Het
Wnt2 T A 6: 18,008,640 N266I possibly damaging Het
Wwp2 AGAACT A 8: 107,506,399 probably null Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17168344 critical splice donor site probably null
IGL00848:Prune2 APN 19 17119118 missense probably damaging 1.00
IGL00862:Prune2 APN 19 17119349 missense probably benign 0.41
IGL00915:Prune2 APN 19 17016253 missense probably damaging 1.00
IGL01084:Prune2 APN 19 17118209 missense probably benign 0.19
IGL01109:Prune2 APN 19 17123879 missense probably benign 0.03
IGL01372:Prune2 APN 19 17125069 missense probably damaging 1.00
IGL01650:Prune2 APN 19 17168292 missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17123903 missense possibly damaging 0.50
IGL01812:Prune2 APN 19 17003777 missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17118638 missense probably benign 0.00
IGL02195:Prune2 APN 19 17119557 missense probably benign 0.00
IGL02502:Prune2 APN 19 17123881 missense probably benign 0.00
IGL02569:Prune2 APN 19 17178859 missense probably damaging 0.99
IGL02693:Prune2 APN 19 17124491 missense probably benign 0.03
IGL02737:Prune2 APN 19 17193411 nonsense probably null
IGL02794:Prune2 APN 19 17119361 missense probably benign 0.19
IGL02985:Prune2 APN 19 17016359 critical splice donor site probably null
IGL03349:Prune2 APN 19 17123346 missense probably damaging 1.00
3-1:Prune2 UTSW 19 17125282 missense probably benign 0.00
R0060:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17122610 missense probably benign 0.00
R0277:Prune2 UTSW 19 17121389 missense probably damaging 0.99
R0321:Prune2 UTSW 19 17120927 missense possibly damaging 0.78
R0321:Prune2 UTSW 19 17122454 missense probably benign 0.39
R0374:Prune2 UTSW 19 17120910 missense probably benign 0.00
R0380:Prune2 UTSW 19 17124007 missense probably damaging 1.00
R0396:Prune2 UTSW 19 17123080 missense probably benign 0.35
R0408:Prune2 UTSW 19 17122310 missense probably benign 0.00
R0421:Prune2 UTSW 19 17123311 missense probably benign 0.02
R0480:Prune2 UTSW 19 17006792 splice site probably benign
R0531:Prune2 UTSW 19 17006753 missense probably damaging 1.00
R0546:Prune2 UTSW 19 17020666 splice site probably benign
R0554:Prune2 UTSW 19 17125218 nonsense probably null
R0659:Prune2 UTSW 19 17122835 missense probably damaging 1.00
R0699:Prune2 UTSW 19 17123955 missense probably damaging 1.00
R0781:Prune2 UTSW 19 17125222 missense probably benign
R1110:Prune2 UTSW 19 17125222 missense probably benign
R1178:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1181:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1337:Prune2 UTSW 19 17119607 missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17212317 missense probably benign 0.40
R1385:Prune2 UTSW 19 17124948 missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17120651 missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17125010 missense probably benign 0.01
R1756:Prune2 UTSW 19 17123704 missense probably benign 0.01
R1765:Prune2 UTSW 19 17125598 missense probably damaging 1.00
R1817:Prune2 UTSW 19 17122081 missense probably benign 0.00
R1838:Prune2 UTSW 19 17199878 missense probably damaging 1.00
R1851:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1852:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1866:Prune2 UTSW 19 17123492 missense probably damaging 1.00
R1911:Prune2 UTSW 19 17113674 missense probably benign 0.02
R1983:Prune2 UTSW 19 17020642 missense probably damaging 0.97
R2014:Prune2 UTSW 19 17120523 missense probably damaging 1.00
R2066:Prune2 UTSW 19 17120678 missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17119745 missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17208238 missense probably damaging 1.00
R2128:Prune2 UTSW 19 17122422 missense probably benign 0.00
R2165:Prune2 UTSW 19 17120182 missense probably benign 0.19
R2241:Prune2 UTSW 19 17123092 missense probably damaging 0.96
R2278:Prune2 UTSW 19 17118555 missense possibly damaging 0.93
R2504:Prune2 UTSW 19 17000036 missense probably damaging 1.00
R2508:Prune2 UTSW 19 17122622 missense probably benign 0.43
R3055:Prune2 UTSW 19 17125043 missense probably damaging 0.98
R3086:Prune2 UTSW 19 17121413 missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3105:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3547:Prune2 UTSW 19 17124348 missense probably damaging 0.96
R3702:Prune2 UTSW 19 17178871 missense probably damaging 1.00
R3753:Prune2 UTSW 19 17125454 missense probably benign 0.38
R3933:Prune2 UTSW 19 17123954 missense probably damaging 1.00
R3935:Prune2 UTSW 19 17199786 missense probably damaging 1.00
R4022:Prune2 UTSW 19 17000020 missense probably damaging 1.00
R4042:Prune2 UTSW 19 17003826 critical splice donor site probably null
R4164:Prune2 UTSW 19 17003734 missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17121910 missense probably benign 0.00
R4642:Prune2 UTSW 19 17020655 critical splice donor site probably null
R4661:Prune2 UTSW 19 17000023 missense probably damaging 1.00
R4666:Prune2 UTSW 19 17120188 nonsense probably null
R4823:Prune2 UTSW 19 17120504 missense probably damaging 1.00
R4897:Prune2 UTSW 19 17121855 missense probably benign 0.03
R4922:Prune2 UTSW 19 17122752 missense probably benign 0.00
R4962:Prune2 UTSW 19 17122273 missense probably benign 0.11
R5026:Prune2 UTSW 19 17199142 missense probably damaging 1.00
R5042:Prune2 UTSW 19 17119797 missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17199910 missense probably damaging 1.00
R5133:Prune2 UTSW 19 17003631 missense probably damaging 1.00
R5184:Prune2 UTSW 19 17216357 missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5339:Prune2 UTSW 19 17120872 missense probably damaging 1.00
R5363:Prune2 UTSW 19 17118266 missense probably damaging 1.00
R5382:Prune2 UTSW 19 17003659 missense probably damaging 1.00
R5436:Prune2 UTSW 19 17020643 missense probably damaging 1.00
R5480:Prune2 UTSW 19 17120947 missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17118209 missense probably benign 0.19
R5678:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5814:Prune2 UTSW 19 17016361 splice site probably null
R5894:Prune2 UTSW 19 17121391 missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17118716 missense probably benign 0.35
R6207:Prune2 UTSW 19 17118116 missense probably damaging 1.00
R6218:Prune2 UTSW 19 17121562 missense probably benign 0.00
R6573:Prune2 UTSW 19 17121157 missense probably damaging 1.00
R6573:Prune2 UTSW 19 17121158 missense possibly damaging 0.61
R6734:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R6805:Prune2 UTSW 19 17120590 missense probably benign
R6837:Prune2 UTSW 19 17178928 missense probably damaging 1.00
R6850:Prune2 UTSW 19 17122188 missense probably benign 0.00
R6858:Prune2 UTSW 19 17118106 missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17123228 missense probably damaging 1.00
R6954:Prune2 UTSW 19 17000021 missense probably damaging 1.00
R7098:Prune2 UTSW 19 17120602 missense probably benign 0.39
R7102:Prune2 UTSW 19 17121213 missense probably benign 0.24
R7246:Prune2 UTSW 19 17121368 missense probably damaging 0.99
R7284:Prune2 UTSW 19 17119886 missense probably damaging 1.00
R7295:Prune2 UTSW 19 17119897 missense probably benign 0.01
R7371:Prune2 UTSW 19 17119370 missense probably benign 0.02
X0019:Prune2 UTSW 19 17121517 missense probably benign 0.16
X0028:Prune2 UTSW 19 17122885 missense probably damaging 1.00
X0064:Prune2 UTSW 19 17122375 missense probably damaging 1.00
X0066:Prune2 UTSW 19 17118790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCCAGTGCATCAAGTCCTGACC -3'
(R):5'- TGCTCTGTTGACTGTCACTGAACG -3'

Sequencing Primer
(F):5'- CGAAGCCCATGTAGATGTCATTAC -3'
(R):5'- GGGCTTGACTTGTTCTCTTTC -3'
Posted On2014-05-23