Incidental Mutation 'R0078:Abcb5'
ID19568
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission 038365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0078 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118927394 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 456 (Q456L)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably benign
Transcript: ENSMUST00000035515
AA Change: Q456L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: Q456L

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100982
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency 81% (203/250)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T A 2: 148,785,825 *131K probably null Het
Abcf1 A G 17: 35,958,062 probably benign Het
Adamts7 A T 9: 90,179,411 S357C probably damaging Het
Ankrd26 A G 6: 118,535,069 probably benign Het
Asb17 T A 3: 153,844,664 V111E probably damaging Het
C1qtnf4 C A 2: 90,889,549 N55K probably damaging Het
C77080 T C 4: 129,227,723 probably null Het
Cacng5 G T 11: 107,877,433 D249E probably benign Het
Camkk2 C A 5: 122,757,559 probably null Het
Ccdc27 T G 4: 154,035,738 probably benign Het
Cngb1 T A 8: 95,264,545 probably null Het
Col7a1 A G 9: 108,974,913 probably benign Het
Corin T A 5: 72,454,473 D148V possibly damaging Het
Defb26 A C 2: 152,508,068 D97E possibly damaging Het
Dgkb A G 12: 38,136,541 N237D probably benign Het
Dsp A G 13: 38,196,017 N1647S probably benign Het
Dtna G A 18: 23,621,442 A438T probably damaging Het
Erbb3 G T 10: 128,583,441 F219L probably damaging Het
EU599041 G A 7: 43,225,851 noncoding transcript Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Fat4 T C 3: 38,888,931 S658P probably benign Het
Fgfr2 C T 7: 130,201,075 D168N possibly damaging Het
Fstl5 T A 3: 76,659,645 probably benign Het
Glmn C T 5: 107,557,970 V451I probably benign Het
Gm8909 A T 17: 36,165,461 S304T possibly damaging Het
Gm9938 T A 19: 23,724,624 probably benign Het
Gpat2 T C 2: 127,428,249 S61P probably damaging Het
Gpr22 T A 12: 31,711,641 M6L probably benign Het
Grm5 T C 7: 88,074,977 L825P probably damaging Het
Gstz1 A T 12: 87,159,703 I66F probably benign Het
H2-T22 A G 17: 36,040,609 V243A probably damaging Het
Hivep1 C T 13: 42,156,041 L586F probably damaging Het
Hmcn2 T G 2: 31,388,344 L1686R probably damaging Het
Ice1 T C 13: 70,603,348 R1540G probably damaging Het
Igha T A 12: 113,259,927 probably benign Het
Kif3a C A 11: 53,578,985 T141K probably benign Het
Knl1 G A 2: 119,069,892 M691I probably benign Het
L3mbtl1 T C 2: 162,947,226 V13A probably benign Het
Lamc1 T A 1: 153,229,190 N1282I probably damaging Het
Lemd2 G T 17: 27,203,728 L231I probably benign Het
Lrrk2 G A 15: 91,734,009 V904M probably benign Het
Lyzl6 C T 11: 103,633,969 S103N probably benign Het
Macf1 T A 4: 123,473,868 R2367W probably damaging Het
Mapk3 T C 7: 126,759,805 Y54H probably damaging Het
Mlh3 A T 12: 85,268,818 V198D probably damaging Het
Myocd T C 11: 65,187,464 S374G possibly damaging Het
Ngef T C 1: 87,540,665 E124G probably benign Het
Nr4a2 T C 2: 57,112,228 Y8C probably damaging Het
Nynrin T A 14: 55,863,332 V193D probably damaging Het
Olfr1280 A T 2: 111,315,904 I142F probably benign Het
Olfr1331 T A 4: 118,869,227 S148T probably benign Het
Olfr1490 G T 19: 13,654,815 V129F probably benign Het
Olfr215 A G 6: 116,582,740 S69P probably damaging Het
Olfr59 A T 11: 74,289,266 I207F probably damaging Het
Pcdh18 T C 3: 49,756,344 Y174C probably damaging Het
Pcf11 T C 7: 92,669,559 D21G possibly damaging Het
Pdia4 A C 6: 47,798,410 F489V possibly damaging Het
Pitrm1 C T 13: 6,575,032 P849S probably damaging Het
Plcz1 T C 6: 139,989,784 Y644C probably damaging Het
Ppp5c T C 7: 17,027,725 E28G probably benign Het
Prkcb A G 7: 122,590,170 Y507C probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Scarf1 A G 11: 75,515,162 probably benign Het
Scoc T A 8: 83,458,258 probably null Het
Sh2d4a A T 8: 68,282,321 M31L probably damaging Het
Spta1 T A 1: 174,207,032 probably benign Het
Stard7 A G 2: 127,292,207 Y270C probably damaging Het
Svs3b T C 2: 164,255,961 T147A probably benign Het
Tmtc3 A G 10: 100,448,961 L604P probably damaging Het
Trim30b A T 7: 104,365,895 N95K probably benign Het
Trpm8 C A 1: 88,328,148 probably benign Het
Tspan9 T C 6: 127,966,485 probably null Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Tyro3 A T 2: 119,817,006 Q872L probably damaging Het
Vmn1r204 G A 13: 22,556,209 M3I probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdfy3 A G 5: 101,888,105 I2149T possibly damaging Het
Wdr66 G A 5: 123,298,570 R1054H probably benign Het
Zfp668 A T 7: 127,868,038 M122K possibly damaging Het
Zkscan1 A T 5: 138,093,101 D32V probably damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118918164 missense probably damaging 1.00
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGATTTTGAGAACCCAGGCAGCAC -3'
(R):5'- TGTGAGGAATGGAGTCTCTCATGGC -3'

Sequencing Primer
(F):5'- GGCAGCACAATCTCACCTTAG -3'
(R):5'- AGCATCATAGCCTGCTTGGT -3'
Posted On2013-04-11