Incidental Mutation 'R0078:Dsp'
ID19571
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Namedesmoplakin
Synonyms5730453H04Rik, DP, 2300002E22Rik
MMRRC Submission 038365-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0078 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location38151294-38198577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38196017 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1647 (N1647S)
Ref Sequence ENSEMBL: ENSMUSP00000117252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
Predicted Effect probably benign
Transcript: ENSMUST00000124830
AA Change: N2246S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: N2246S

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127906
AA Change: N1647S

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: N1647S

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency 81% (203/250)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T A 2: 148,785,825 *131K probably null Het
Abcb5 T A 12: 118,927,394 Q456L probably benign Het
Abcf1 A G 17: 35,958,062 probably benign Het
Adamts7 A T 9: 90,179,411 S357C probably damaging Het
Ankrd26 A G 6: 118,535,069 probably benign Het
Asb17 T A 3: 153,844,664 V111E probably damaging Het
C1qtnf4 C A 2: 90,889,549 N55K probably damaging Het
C77080 T C 4: 129,227,723 probably null Het
Cacng5 G T 11: 107,877,433 D249E probably benign Het
Camkk2 C A 5: 122,757,559 probably null Het
Ccdc27 T G 4: 154,035,738 probably benign Het
Cngb1 T A 8: 95,264,545 probably null Het
Col7a1 A G 9: 108,974,913 probably benign Het
Corin T A 5: 72,454,473 D148V possibly damaging Het
Defb26 A C 2: 152,508,068 D97E possibly damaging Het
Dgkb A G 12: 38,136,541 N237D probably benign Het
Dtna G A 18: 23,621,442 A438T probably damaging Het
Erbb3 G T 10: 128,583,441 F219L probably damaging Het
EU599041 G A 7: 43,225,851 noncoding transcript Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Fat4 T C 3: 38,888,931 S658P probably benign Het
Fgfr2 C T 7: 130,201,075 D168N possibly damaging Het
Fstl5 T A 3: 76,659,645 probably benign Het
Glmn C T 5: 107,557,970 V451I probably benign Het
Gm8909 A T 17: 36,165,461 S304T possibly damaging Het
Gm9938 T A 19: 23,724,624 probably benign Het
Gpat2 T C 2: 127,428,249 S61P probably damaging Het
Gpr22 T A 12: 31,711,641 M6L probably benign Het
Grm5 T C 7: 88,074,977 L825P probably damaging Het
Gstz1 A T 12: 87,159,703 I66F probably benign Het
H2-T22 A G 17: 36,040,609 V243A probably damaging Het
Hivep1 C T 13: 42,156,041 L586F probably damaging Het
Hmcn2 T G 2: 31,388,344 L1686R probably damaging Het
Ice1 T C 13: 70,603,348 R1540G probably damaging Het
Igha T A 12: 113,259,927 probably benign Het
Kif3a C A 11: 53,578,985 T141K probably benign Het
Knl1 G A 2: 119,069,892 M691I probably benign Het
L3mbtl1 T C 2: 162,947,226 V13A probably benign Het
Lamc1 T A 1: 153,229,190 N1282I probably damaging Het
Lemd2 G T 17: 27,203,728 L231I probably benign Het
Lrrk2 G A 15: 91,734,009 V904M probably benign Het
Lyzl6 C T 11: 103,633,969 S103N probably benign Het
Macf1 T A 4: 123,473,868 R2367W probably damaging Het
Mapk3 T C 7: 126,759,805 Y54H probably damaging Het
Mlh3 A T 12: 85,268,818 V198D probably damaging Het
Myocd T C 11: 65,187,464 S374G possibly damaging Het
Ngef T C 1: 87,540,665 E124G probably benign Het
Nr4a2 T C 2: 57,112,228 Y8C probably damaging Het
Nynrin T A 14: 55,863,332 V193D probably damaging Het
Olfr1280 A T 2: 111,315,904 I142F probably benign Het
Olfr1331 T A 4: 118,869,227 S148T probably benign Het
Olfr1490 G T 19: 13,654,815 V129F probably benign Het
Olfr215 A G 6: 116,582,740 S69P probably damaging Het
Olfr59 A T 11: 74,289,266 I207F probably damaging Het
Pcdh18 T C 3: 49,756,344 Y174C probably damaging Het
Pcf11 T C 7: 92,669,559 D21G possibly damaging Het
Pdia4 A C 6: 47,798,410 F489V possibly damaging Het
Pitrm1 C T 13: 6,575,032 P849S probably damaging Het
Plcz1 T C 6: 139,989,784 Y644C probably damaging Het
Ppp5c T C 7: 17,027,725 E28G probably benign Het
Prkcb A G 7: 122,590,170 Y507C probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Scarf1 A G 11: 75,515,162 probably benign Het
Scoc T A 8: 83,458,258 probably null Het
Sh2d4a A T 8: 68,282,321 M31L probably damaging Het
Spta1 T A 1: 174,207,032 probably benign Het
Stard7 A G 2: 127,292,207 Y270C probably damaging Het
Svs3b T C 2: 164,255,961 T147A probably benign Het
Tmtc3 A G 10: 100,448,961 L604P probably damaging Het
Trim30b A T 7: 104,365,895 N95K probably benign Het
Trpm8 C A 1: 88,328,148 probably benign Het
Tspan9 T C 6: 127,966,485 probably null Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Tyro3 A T 2: 119,817,006 Q872L probably damaging Het
Vmn1r204 G A 13: 22,556,209 M3I probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdfy3 A G 5: 101,888,105 I2149T possibly damaging Het
Wdr66 G A 5: 123,298,570 R1054H probably benign Het
Zfp668 A T 7: 127,868,038 M122K possibly damaging Het
Zkscan1 A T 5: 138,093,101 D32V probably damaging Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38197846 missense probably damaging 0.99
IGL01337:Dsp APN 13 38192687 missense probably benign 0.44
IGL01371:Dsp APN 13 38193617 missense probably benign 0.13
IGL01473:Dsp APN 13 38167571 missense probably damaging 0.99
IGL01660:Dsp APN 13 38176495 missense possibly damaging 0.90
IGL01723:Dsp APN 13 38179084 missense probably damaging 1.00
IGL01999:Dsp APN 13 38181186 missense probably damaging 0.99
IGL02313:Dsp APN 13 38196523 nonsense probably null
IGL02833:Dsp APN 13 38192921 missense possibly damaging 0.56
IGL03050:Dsp APN 13 38188445 splice site probably benign
IGL03353:Dsp APN 13 38186695 missense probably damaging 1.00
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0230:Dsp UTSW 13 38197705 missense probably benign 0.03
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0285:Dsp UTSW 13 38172794 missense probably benign
R0326:Dsp UTSW 13 38192870 nonsense probably null
R0332:Dsp UTSW 13 38182228 nonsense probably null
R0471:Dsp UTSW 13 38193350 nonsense probably null
R0567:Dsp UTSW 13 38192438 missense probably benign 0.01
R0611:Dsp UTSW 13 38187741 missense probably damaging 1.00
R0718:Dsp UTSW 13 38196764 missense possibly damaging 0.80
R0926:Dsp UTSW 13 38183218 missense probably damaging 0.97
R1078:Dsp UTSW 13 38183106 splice site probably benign
R1183:Dsp UTSW 13 38191740 nonsense probably null
R1188:Dsp UTSW 13 38194963 missense probably damaging 1.00
R1419:Dsp UTSW 13 38186695 missense probably damaging 1.00
R1445:Dsp UTSW 13 38191931 missense probably damaging 0.98
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1478:Dsp UTSW 13 38181138 missense probably damaging 1.00
R1568:Dsp UTSW 13 38175147 missense probably damaging 1.00
R1572:Dsp UTSW 13 38195738 missense probably damaging 1.00
R1676:Dsp UTSW 13 38193374 nonsense probably null
R1736:Dsp UTSW 13 38192990 missense probably benign 0.01
R1776:Dsp UTSW 13 38196617 missense probably damaging 0.99
R1829:Dsp UTSW 13 38193195 missense probably damaging 1.00
R1878:Dsp UTSW 13 38164855 missense possibly damaging 0.53
R2013:Dsp UTSW 13 38191458 missense probably damaging 1.00
R2161:Dsp UTSW 13 38196451 missense probably damaging 1.00
R2187:Dsp UTSW 13 38176407 missense probably damaging 1.00
R2295:Dsp UTSW 13 38197046 missense probably benign 0.28
R2495:Dsp UTSW 13 38193477 missense possibly damaging 0.91
R2566:Dsp UTSW 13 38196404 missense probably damaging 1.00
R2888:Dsp UTSW 13 38192248 missense possibly damaging 0.92
R3012:Dsp UTSW 13 38193342 missense possibly damaging 0.61
R3614:Dsp UTSW 13 38177199 missense probably damaging 0.98
R3725:Dsp UTSW 13 38194689 splice site probably null
R3725:Dsp UTSW 13 38197618 missense probably benign 0.00
R3797:Dsp UTSW 13 38177284 critical splice donor site probably null
R3841:Dsp UTSW 13 38197705 missense probably benign
R4030:Dsp UTSW 13 38191428 missense possibly damaging 0.84
R4124:Dsp UTSW 13 38186713 missense probably damaging 1.00
R4279:Dsp UTSW 13 38185231 missense probably damaging 1.00
R4334:Dsp UTSW 13 38196664 missense possibly damaging 0.46
R4419:Dsp UTSW 13 38195132 missense probably damaging 1.00
R4615:Dsp UTSW 13 38191632 missense probably damaging 0.98
R4627:Dsp UTSW 13 38168641 missense probably benign 0.01
R4639:Dsp UTSW 13 38196784 missense probably damaging 1.00
R4687:Dsp UTSW 13 38191619 missense probably damaging 1.00
R4735:Dsp UTSW 13 38196040 missense probably damaging 0.99
R4746:Dsp UTSW 13 38195104 missense possibly damaging 0.51
R4772:Dsp UTSW 13 38167528 nonsense probably null
R4830:Dsp UTSW 13 38192864 missense probably benign
R4850:Dsp UTSW 13 38192469 missense probably damaging 1.00
R4959:Dsp UTSW 13 38191710 missense probably benign 0.41
R4963:Dsp UTSW 13 38197870 missense probably damaging 0.99
R4969:Dsp UTSW 13 38192910 missense probably benign 0.00
R4978:Dsp UTSW 13 38182234 missense probably damaging 1.00
R4989:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5068:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5069:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5070:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5133:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5138:Dsp UTSW 13 38183298 missense probably benign 0.37
R5138:Dsp UTSW 13 38195845 missense possibly damaging 0.50
R5153:Dsp UTSW 13 38182306 missense probably damaging 1.00
R5199:Dsp UTSW 13 38192902 nonsense probably null
R5226:Dsp UTSW 13 38186770 missense probably damaging 0.99
R5265:Dsp UTSW 13 38195183 missense possibly damaging 0.95
R5371:Dsp UTSW 13 38194889 missense probably damaging 0.97
R5484:Dsp UTSW 13 38184038 missense possibly damaging 0.48
R5534:Dsp UTSW 13 38195842 missense probably benign 0.01
R5569:Dsp UTSW 13 38192652 missense probably benign 0.01
R5854:Dsp UTSW 13 38167501 splice site probably null
R5910:Dsp UTSW 13 38192469 missense possibly damaging 0.95
R5929:Dsp UTSW 13 38195434 missense possibly damaging 0.92
R5940:Dsp UTSW 13 38196026 missense possibly damaging 0.70
R5948:Dsp UTSW 13 38195401 missense possibly damaging 0.95
R5955:Dsp UTSW 13 38194958 missense possibly damaging 0.73
R5970:Dsp UTSW 13 38195702 missense possibly damaging 0.93
R6054:Dsp UTSW 13 38167609 missense probably benign 0.00
R6113:Dsp UTSW 13 38192047 missense probably damaging 1.00
R6139:Dsp UTSW 13 38192406 missense probably damaging 0.97
R6328:Dsp UTSW 13 38197006 nonsense probably null
R6527:Dsp UTSW 13 38195873 missense probably damaging 1.00
R6573:Dsp UTSW 13 38196862 missense probably damaging 1.00
R6628:Dsp UTSW 13 38167622 missense possibly damaging 0.73
R6738:Dsp UTSW 13 38192210 missense possibly damaging 0.87
R6898:Dsp UTSW 13 38192217 missense possibly damaging 0.59
R6919:Dsp UTSW 13 38167655 missense possibly damaging 0.84
R6951:Dsp UTSW 13 38167646 missense possibly damaging 0.95
R7017:Dsp UTSW 13 38186707 missense probably benign 0.02
R7022:Dsp UTSW 13 38191740 missense probably benign 0.06
R7135:Dsp UTSW 13 38179073 missense probably damaging 1.00
R7192:Dsp UTSW 13 38195593 missense probably benign 0.09
R7211:Dsp UTSW 13 38188535 critical splice donor site probably null
R7251:Dsp UTSW 13 38193548 missense probably benign 0.02
R7326:Dsp UTSW 13 38192883 missense probably benign 0.01
R7369:Dsp UTSW 13 38197525 missense possibly damaging 0.82
R7376:Dsp UTSW 13 38172843 missense probably damaging 1.00
R7406:Dsp UTSW 13 38197196 missense possibly damaging 0.63
R7439:Dsp UTSW 13 38176502 critical splice donor site probably null
R7439:Dsp UTSW 13 38195449 missense probably benign 0.00
R7441:Dsp UTSW 13 38195449 missense probably benign 0.00
R7477:Dsp UTSW 13 38172863 missense probably damaging 1.00
R7535:Dsp UTSW 13 38192789 missense probably benign 0.05
R7558:Dsp UTSW 13 38168766 missense probably benign 0.02
R7600:Dsp UTSW 13 38191715 missense probably damaging 1.00
R7616:Dsp UTSW 13 38191482 missense probably damaging 0.98
R7702:Dsp UTSW 13 38175207 missense possibly damaging 0.83
R7738:Dsp UTSW 13 38185175 missense probably damaging 0.97
R7815:Dsp UTSW 13 38191470 missense probably benign 0.31
R7882:Dsp UTSW 13 38184018 missense possibly damaging 0.76
R7917:Dsp UTSW 13 38167639 nonsense probably null
R7971:Dsp UTSW 13 38192523 missense probably damaging 0.97
R8104:Dsp UTSW 13 38168624 missense probably benign 0.03
R8176:Dsp UTSW 13 38192810 missense possibly damaging 0.56
R8303:Dsp UTSW 13 38197343 missense probably benign
R8323:Dsp UTSW 13 38172830 missense possibly damaging 0.80
R8326:Dsp UTSW 13 38191635 missense probably damaging 1.00
R8358:Dsp UTSW 13 38192481 missense possibly damaging 0.92
R8410:Dsp UTSW 13 38196815 missense possibly damaging 0.94
R8552:Dsp UTSW 13 38185141 missense probably damaging 0.98
R8713:Dsp UTSW 13 38168725 missense probably damaging 0.99
R8801:Dsp UTSW 13 38197526 missense possibly damaging 0.81
R8900:Dsp UTSW 13 38181179 missense probably damaging 0.99
R8901:Dsp UTSW 13 38181179 missense probably damaging 0.99
X0023:Dsp UTSW 13 38197684 missense probably benign 0.00
X0024:Dsp UTSW 13 38193255 missense probably benign 0.04
X0027:Dsp UTSW 13 38186646 missense possibly damaging 0.68
X0067:Dsp UTSW 13 38182312 missense possibly damaging 0.85
Z1176:Dsp UTSW 13 38197190 missense possibly damaging 0.81
Z1177:Dsp UTSW 13 38151689 missense probably benign 0.01
Z1177:Dsp UTSW 13 38192854 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCAAGAAGAAGGTCAGCTACATGC -3'
(R):5'- TCTTTGAACTCAATGCCCACCAGAC -3'

Sequencing Primer
(F):5'- TTCCAGGGAATCAGACAACC -3'
(R):5'- CAGGTAGCCTTAAATTGCTGACG -3'
Posted On2013-04-11