Incidental Mutation 'R0078:Olfr1490'
ID19581
Institutional Source Beutler Lab
Gene Symbol Olfr1490
Ensembl Gene ENSMUSG00000061387
Gene Nameolfactory receptor 1490
SynonymsMOR266-6P, GA_x6K02T2RE5P-3987000-3987950
MMRRC Submission 038365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0078 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13651091-13659545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13654815 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 129 (V129F)
Ref Sequence ENSEMBL: ENSMUSP00000151186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080162] [ENSMUST00000208667] [ENSMUST00000213900]
Predicted Effect probably benign
Transcript: ENSMUST00000080162
AA Change: V124F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079057
Gene: ENSMUSG00000061387
AA Change: V124F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-48 PFAM
Pfam:7tm_1 41 290 2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208667
AA Change: V129F
Predicted Effect probably benign
Transcript: ENSMUST00000213900
AA Change: V129F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216631
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency 81% (203/250)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T A 2: 148,785,825 *131K probably null Het
Abcb5 T A 12: 118,927,394 Q456L probably benign Het
Abcf1 A G 17: 35,958,062 probably benign Het
Adamts7 A T 9: 90,179,411 S357C probably damaging Het
Ankrd26 A G 6: 118,535,069 probably benign Het
Asb17 T A 3: 153,844,664 V111E probably damaging Het
C1qtnf4 C A 2: 90,889,549 N55K probably damaging Het
C77080 T C 4: 129,227,723 probably null Het
Cacng5 G T 11: 107,877,433 D249E probably benign Het
Camkk2 C A 5: 122,757,559 probably null Het
Ccdc27 T G 4: 154,035,738 probably benign Het
Cngb1 T A 8: 95,264,545 probably null Het
Col7a1 A G 9: 108,974,913 probably benign Het
Corin T A 5: 72,454,473 D148V possibly damaging Het
Defb26 A C 2: 152,508,068 D97E possibly damaging Het
Dgkb A G 12: 38,136,541 N237D probably benign Het
Dsp A G 13: 38,196,017 N1647S probably benign Het
Dtna G A 18: 23,621,442 A438T probably damaging Het
Erbb3 G T 10: 128,583,441 F219L probably damaging Het
EU599041 G A 7: 43,225,851 noncoding transcript Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Fat4 T C 3: 38,888,931 S658P probably benign Het
Fgfr2 C T 7: 130,201,075 D168N possibly damaging Het
Fstl5 T A 3: 76,659,645 probably benign Het
Glmn C T 5: 107,557,970 V451I probably benign Het
Gm8909 A T 17: 36,165,461 S304T possibly damaging Het
Gm9938 T A 19: 23,724,624 probably benign Het
Gpat2 T C 2: 127,428,249 S61P probably damaging Het
Gpr22 T A 12: 31,711,641 M6L probably benign Het
Grm5 T C 7: 88,074,977 L825P probably damaging Het
Gstz1 A T 12: 87,159,703 I66F probably benign Het
H2-T22 A G 17: 36,040,609 V243A probably damaging Het
Hivep1 C T 13: 42,156,041 L586F probably damaging Het
Hmcn2 T G 2: 31,388,344 L1686R probably damaging Het
Ice1 T C 13: 70,603,348 R1540G probably damaging Het
Igha T A 12: 113,259,927 probably benign Het
Kif3a C A 11: 53,578,985 T141K probably benign Het
Knl1 G A 2: 119,069,892 M691I probably benign Het
L3mbtl1 T C 2: 162,947,226 V13A probably benign Het
Lamc1 T A 1: 153,229,190 N1282I probably damaging Het
Lemd2 G T 17: 27,203,728 L231I probably benign Het
Lrrk2 G A 15: 91,734,009 V904M probably benign Het
Lyzl6 C T 11: 103,633,969 S103N probably benign Het
Macf1 T A 4: 123,473,868 R2367W probably damaging Het
Mapk3 T C 7: 126,759,805 Y54H probably damaging Het
Mlh3 A T 12: 85,268,818 V198D probably damaging Het
Myocd T C 11: 65,187,464 S374G possibly damaging Het
Ngef T C 1: 87,540,665 E124G probably benign Het
Nr4a2 T C 2: 57,112,228 Y8C probably damaging Het
Nynrin T A 14: 55,863,332 V193D probably damaging Het
Olfr1280 A T 2: 111,315,904 I142F probably benign Het
Olfr1331 T A 4: 118,869,227 S148T probably benign Het
Olfr215 A G 6: 116,582,740 S69P probably damaging Het
Olfr59 A T 11: 74,289,266 I207F probably damaging Het
Pcdh18 T C 3: 49,756,344 Y174C probably damaging Het
Pcf11 T C 7: 92,669,559 D21G possibly damaging Het
Pdia4 A C 6: 47,798,410 F489V possibly damaging Het
Pitrm1 C T 13: 6,575,032 P849S probably damaging Het
Plcz1 T C 6: 139,989,784 Y644C probably damaging Het
Ppp5c T C 7: 17,027,725 E28G probably benign Het
Prkcb A G 7: 122,590,170 Y507C probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Scarf1 A G 11: 75,515,162 probably benign Het
Scoc T A 8: 83,458,258 probably null Het
Sh2d4a A T 8: 68,282,321 M31L probably damaging Het
Spta1 T A 1: 174,207,032 probably benign Het
Stard7 A G 2: 127,292,207 Y270C probably damaging Het
Svs3b T C 2: 164,255,961 T147A probably benign Het
Tmtc3 A G 10: 100,448,961 L604P probably damaging Het
Trim30b A T 7: 104,365,895 N95K probably benign Het
Trpm8 C A 1: 88,328,148 probably benign Het
Tspan9 T C 6: 127,966,485 probably null Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Tyro3 A T 2: 119,817,006 Q872L probably damaging Het
Vmn1r204 G A 13: 22,556,209 M3I probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdfy3 A G 5: 101,888,105 I2149T possibly damaging Het
Wdr66 G A 5: 123,298,570 R1054H probably benign Het
Zfp668 A T 7: 127,868,038 M122K possibly damaging Het
Zkscan1 A T 5: 138,093,101 D32V probably damaging Het
Other mutations in Olfr1490
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr1490 APN 19 13654933 missense probably damaging 0.96
IGL01335:Olfr1490 APN 19 13655176 missense probably damaging 1.00
IGL01561:Olfr1490 APN 19 13654905 missense probably benign
IGL01644:Olfr1490 APN 19 13655404 utr 3 prime probably benign
IGL02257:Olfr1490 APN 19 13655265 missense probably benign
IGL02282:Olfr1490 APN 19 13655258 missense probably damaging 1.00
IGL02355:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02362:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02639:Olfr1490 APN 19 13654596 missense possibly damaging 0.73
R0278:Olfr1490 UTSW 19 13654764 missense probably damaging 1.00
R0278:Olfr1490 UTSW 19 13654765 missense probably damaging 1.00
R0506:Olfr1490 UTSW 19 13654897 missense possibly damaging 0.62
R0927:Olfr1490 UTSW 19 13654452 missense probably damaging 0.99
R1087:Olfr1490 UTSW 19 13655012 nonsense probably null
R1762:Olfr1490 UTSW 19 13654504 missense probably benign
R2901:Olfr1490 UTSW 19 13654945 missense probably damaging 1.00
R2907:Olfr1490 UTSW 19 13655247 missense possibly damaging 0.84
R3625:Olfr1490 UTSW 19 13654982 nonsense probably null
R3838:Olfr1490 UTSW 19 13654957 missense probably benign 0.00
R4745:Olfr1490 UTSW 19 13655386 missense probably benign
R4804:Olfr1490 UTSW 19 13654518 missense probably benign
R5026:Olfr1490 UTSW 19 13654932 missense probably benign 0.03
R5314:Olfr1490 UTSW 19 13655266 missense probably benign 0.08
R6052:Olfr1490 UTSW 19 13654507 missense possibly damaging 0.95
R6235:Olfr1490 UTSW 19 13654781 nonsense probably null
R7405:Olfr1490 UTSW 19 13654882 missense probably benign 0.14
R7557:Olfr1490 UTSW 19 13655026 missense possibly damaging 0.71
R8038:Olfr1490 UTSW 19 13655355 missense possibly damaging 0.91
R8338:Olfr1490 UTSW 19 13654852 missense possibly damaging 0.92
R8366:Olfr1490 UTSW 19 13654539 missense probably damaging 1.00
Z1176:Olfr1490 UTSW 19 13654463 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCTTGCCTATCCAAAACGTCCAG -3'
(R):5'- AGAAGTGCTCTATTCCCCTGTCCTG -3'

Sequencing Primer
(F):5'- AGAGCTACGTATGCTCTGC -3'
(R):5'- CCTGTCCTGACAGAATGGTAGAC -3'
Posted On2013-04-11