Incidental Mutation 'R0079:Dhrs3'
ID19598
Institutional Source Beutler Lab
Gene Symbol Dhrs3
Ensembl Gene ENSMUSG00000066026
Gene Namedehydrogenase/reductase (SDR family) member 3
SynonymsRsdr1, retSDR1
MMRRC Submission 038366-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0079 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144892827-144928209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144920048 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 197 (S197C)
Ref Sequence ENSEMBL: ENSMUSP00000126154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084184] [ENSMUST00000105744] [ENSMUST00000142808] [ENSMUST00000154208] [ENSMUST00000171001]
Predicted Effect probably benign
Transcript: ENSMUST00000084184
SMART Domains Protein: ENSMUSP00000081200
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 39 121 1.7e-19 PFAM
Pfam:KR 40 119 1.5e-16 PFAM
Pfam:Polysacc_synt_2 41 121 1.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105744
AA Change: S157C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101370
Gene: ENSMUSG00000066026
AA Change: S157C

DomainStartEndE-ValueType
Pfam:adh_short 13 92 2.1e-18 PFAM
Pfam:KR 14 93 1.5e-15 PFAM
Pfam:Polysacc_synt_2 15 90 4.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133265
Predicted Effect probably benign
Transcript: ENSMUST00000142808
SMART Domains Protein: ENSMUSP00000122578
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 13 146 6.1e-29 PFAM
Pfam:KR 14 139 5.9e-20 PFAM
Pfam:Polysacc_synt_2 15 109 4.2e-10 PFAM
Pfam:Epimerase 15 124 3.8e-8 PFAM
Pfam:adh_short_C2 19 146 3.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154208
AA Change: S223C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122552
Gene: ENSMUSG00000066026
AA Change: S223C

DomainStartEndE-ValueType
Pfam:adh_short 39 233 7.8e-42 PFAM
Pfam:KR 40 213 2.3e-21 PFAM
Pfam:Polysacc_synt_2 41 132 2.8e-9 PFAM
Pfam:adh_short_C2 45 205 4.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171001
AA Change: S197C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126154
Gene: ENSMUSG00000066026
AA Change: S197C

DomainStartEndE-ValueType
Pfam:adh_short 13 181 2.1e-34 PFAM
Pfam:KR 14 191 2.7e-21 PFAM
Pfam:Polysacc_synt_2 15 106 1.8e-9 PFAM
Pfam:Epimerase 15 124 2e-7 PFAM
Pfam:adh_short_C2 19 179 2e-14 PFAM
Meta Mutation Damage Score 0.1817 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency 78% (155/199)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short-chain dehydrogenases/reductases (SDRs), such as DHRS3, catalyze the oxidation/reduction of a wide range of substrates, including retinoids and steroids (Haeseleer and Palczewski, 2000 [PubMed 10800688]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a targeted mutation die before weaning age. Mice homozygous for a gene trap allele exhibit perinatal lethality, altered retinoid metabolism and heart, craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,007,182 T105S possibly damaging Het
Abca13 G A 11: 9,293,493 M1785I probably benign Het
Adamts3 G C 5: 89,693,053 P804A probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ank2 G T 3: 126,934,615 D776E probably benign Het
Cep152 T A 2: 125,618,453 K193M possibly damaging Het
Cep55 C T 19: 38,060,321 L142F probably benign Het
Chd5 A G 4: 152,385,749 Y1884C probably damaging Het
Clasp1 T C 1: 118,543,304 L890P probably damaging Het
Cul9 C A 17: 46,537,663 E716* probably null Het
Cytip T A 2: 58,159,994 D21V probably benign Het
Denr T G 5: 123,924,845 F137C probably damaging Het
Egr4 A T 6: 85,512,769 M103K probably damaging Het
Eif4enif1 C T 11: 3,242,676 Q835* probably null Het
Gckr A G 5: 31,306,539 I268V probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Hpd T C 5: 123,181,481 Y8C probably damaging Het
Il12rb2 A T 6: 67,361,905 F16I probably benign Het
Ildr2 A T 1: 166,307,720 Y347F probably damaging Het
Kcnv1 T C 15: 45,113,333 D186G probably damaging Het
Khdrbs2 A G 1: 32,519,915 probably null Het
L1cam G T X: 73,869,758 P16H probably damaging Het
Lyn A G 4: 3,746,768 H161R probably damaging Het
Mctp2 T A 7: 72,214,116 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mitf A C 6: 97,996,440 M220L probably benign Het
Mrpl21 T C 19: 3,284,807 Y50H possibly damaging Het
Myh1 T A 11: 67,213,411 L968Q probably damaging Het
Myo3b A G 2: 70,095,158 K18E possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp2 T A 7: 5,327,730 T556S possibly damaging Het
Nsmf T C 2: 25,059,084 probably benign Het
Nsun7 C T 5: 66,295,513 P558S probably benign Het
Olfr1168 A T 2: 88,185,354 Y159F possibly damaging Het
Olfr1564 G A 17: 33,216,105 R80C probably benign Het
Olfr394 T G 11: 73,887,737 I212L probably benign Het
Olfr679 T C 7: 105,085,928 S71P probably damaging Het
Papd5 T A 8: 88,200,003 Y14N possibly damaging Het
Phf19 T C 2: 34,895,954 N501S probably benign Het
Ranbp17 A C 11: 33,500,682 I85S probably damaging Het
Robo1 A G 16: 72,933,342 probably benign Het
Sntg1 A G 1: 8,679,062 probably benign Het
Snx15 A G 19: 6,123,913 L58P probably damaging Het
Spink5 G T 18: 43,977,764 C134F probably damaging Het
Strip2 T C 6: 29,920,533 probably null Het
Taf1d C T 9: 15,309,944 A182V probably benign Het
Tenm3 A G 8: 48,343,345 V475A possibly damaging Het
Tgds A T 14: 118,116,235 H223Q possibly damaging Het
Thoc2 G T X: 41,864,108 S230Y probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Trak2 A T 1: 58,926,724 L97Q probably damaging Het
Trnau1ap A G 4: 132,314,345 Y145H probably damaging Het
Vars2 A T 17: 35,659,156 D780E probably damaging Het
Vmn1r170 T A 7: 23,606,310 S46T possibly damaging Het
Vmn1r20 A T 6: 57,431,792 R34S possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdr64 T C 1: 175,795,102 M805T probably benign Het
Xdh G A 17: 73,891,218 R1225C probably damaging Het
Zfp341 T A 2: 154,624,994 Y94* probably null Het
Zfp641 T C 15: 98,289,089 N218D probably benign Het
Zscan22 T C 7: 12,904,087 probably null Het
Other mutations in Dhrs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Dhrs3 APN 4 144919472 missense probably damaging 0.96
IGL02226:Dhrs3 APN 4 144923949 missense possibly damaging 0.94
IGL02236:Dhrs3 APN 4 144893563 missense probably benign
IGL02728:Dhrs3 APN 4 144920072 missense probably damaging 0.98
R0734:Dhrs3 UTSW 4 144927176 missense probably damaging 0.99
R1474:Dhrs3 UTSW 4 144919487 missense probably damaging 1.00
R1632:Dhrs3 UTSW 4 144893546 missense probably benign 0.30
R2010:Dhrs3 UTSW 4 144927188 missense possibly damaging 0.49
R3162:Dhrs3 UTSW 4 144919446 missense possibly damaging 0.80
R3162:Dhrs3 UTSW 4 144919446 missense possibly damaging 0.80
R3176:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R3276:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R3440:Dhrs3 UTSW 4 144920058 missense probably damaging 1.00
R3709:Dhrs3 UTSW 4 144893711 critical splice donor site probably null
R3795:Dhrs3 UTSW 4 144919392 missense probably damaging 0.99
R5571:Dhrs3 UTSW 4 144893564 missense probably benign 0.34
R5943:Dhrs3 UTSW 4 144919976 missense possibly damaging 0.88
R6457:Dhrs3 UTSW 4 144919952 missense probably damaging 1.00
R7607:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R8144:Dhrs3 UTSW 4 144919904 missense probably damaging 1.00
R8371:Dhrs3 UTSW 4 144919383 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCCATATTGTGTGCCTCAATTCCG -3'
(R):5'- AGCTCCTGTACTAAGAAGCAGGACC -3'

Sequencing Primer
(F):5'- GTGCTTGCACTGTCAGC -3'
(R):5'- gtaacctcaacagacccttcc -3'
Posted On2013-04-11