Incidental Mutation 'R0079:Denr'
ID19604
Institutional Source Beutler Lab
Gene Symbol Denr
Ensembl Gene ENSMUSG00000023106
Gene Namedensity-regulated protein
Synonyms1500003K04Rik
MMRRC Submission 038366-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0079 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123907175-123928835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 123924845 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 137 (F137C)
Ref Sequence ENSEMBL: ENSMUSP00000023869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023869] [ENSMUST00000166129] [ENSMUST00000166233]
Predicted Effect probably damaging
Transcript: ENSMUST00000023869
AA Change: F137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023869
Gene: ENSMUSG00000023106
AA Change: F137C

DomainStartEndE-ValueType
Pfam:SUI1 111 184 3.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166129
SMART Domains Protein: ENSMUSP00000143501
Gene: ENSMUSG00000105875

DomainStartEndE-ValueType
coiled coil region 16 109 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166233
AA Change: F137C

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126174
Gene: ENSMUSG00000023106
AA Change: F137C

DomainStartEndE-ValueType
Pfam:SUI1 108 183 4e-19 PFAM
Meta Mutation Damage Score 0.7199 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency 78% (155/199)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein whose expression was found to increase in cultured cells at high density but not during growth arrest. This gene was also shown to have increased expression in cells overexpressing HER-2/neu proto-oncogene. The protein contains an SUI1 domain. In budding yeast, SUI1 is a translation initiation factor that along with eIF-2 and the initiator tRNA-Met, directs the ribosome to the proper translation start site. Proteins similar to SUI have been found in mammals, insects, and plants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,007,182 T105S possibly damaging Het
Abca13 G A 11: 9,293,493 M1785I probably benign Het
Adamts3 G C 5: 89,693,053 P804A probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ank2 G T 3: 126,934,615 D776E probably benign Het
Cep152 T A 2: 125,618,453 K193M possibly damaging Het
Cep55 C T 19: 38,060,321 L142F probably benign Het
Chd5 A G 4: 152,385,749 Y1884C probably damaging Het
Clasp1 T C 1: 118,543,304 L890P probably damaging Het
Cul9 C A 17: 46,537,663 E716* probably null Het
Cytip T A 2: 58,159,994 D21V probably benign Het
Dhrs3 A T 4: 144,920,048 S197C probably damaging Het
Egr4 A T 6: 85,512,769 M103K probably damaging Het
Eif4enif1 C T 11: 3,242,676 Q835* probably null Het
Gckr A G 5: 31,306,539 I268V probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Hpd T C 5: 123,181,481 Y8C probably damaging Het
Il12rb2 A T 6: 67,361,905 F16I probably benign Het
Ildr2 A T 1: 166,307,720 Y347F probably damaging Het
Kcnv1 T C 15: 45,113,333 D186G probably damaging Het
Khdrbs2 A G 1: 32,519,915 probably null Het
L1cam G T X: 73,869,758 P16H probably damaging Het
Lyn A G 4: 3,746,768 H161R probably damaging Het
Mctp2 T A 7: 72,214,116 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mitf A C 6: 97,996,440 M220L probably benign Het
Mrpl21 T C 19: 3,284,807 Y50H possibly damaging Het
Myh1 T A 11: 67,213,411 L968Q probably damaging Het
Myo3b A G 2: 70,095,158 K18E possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp2 T A 7: 5,327,730 T556S possibly damaging Het
Nsmf T C 2: 25,059,084 probably benign Het
Nsun7 C T 5: 66,295,513 P558S probably benign Het
Olfr1168 A T 2: 88,185,354 Y159F possibly damaging Het
Olfr1564 G A 17: 33,216,105 R80C probably benign Het
Olfr394 T G 11: 73,887,737 I212L probably benign Het
Olfr679 T C 7: 105,085,928 S71P probably damaging Het
Papd5 T A 8: 88,200,003 Y14N possibly damaging Het
Phf19 T C 2: 34,895,954 N501S probably benign Het
Ranbp17 A C 11: 33,500,682 I85S probably damaging Het
Robo1 A G 16: 72,933,342 probably benign Het
Sntg1 A G 1: 8,679,062 probably benign Het
Snx15 A G 19: 6,123,913 L58P probably damaging Het
Spink5 G T 18: 43,977,764 C134F probably damaging Het
Strip2 T C 6: 29,920,533 probably null Het
Taf1d C T 9: 15,309,944 A182V probably benign Het
Tenm3 A G 8: 48,343,345 V475A possibly damaging Het
Tgds A T 14: 118,116,235 H223Q possibly damaging Het
Thoc2 G T X: 41,864,108 S230Y probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Trak2 A T 1: 58,926,724 L97Q probably damaging Het
Trnau1ap A G 4: 132,314,345 Y145H probably damaging Het
Vars2 A T 17: 35,659,156 D780E probably damaging Het
Vmn1r170 T A 7: 23,606,310 S46T possibly damaging Het
Vmn1r20 A T 6: 57,431,792 R34S possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdr64 T C 1: 175,795,102 M805T probably benign Het
Xdh G A 17: 73,891,218 R1225C probably damaging Het
Zfp341 T A 2: 154,624,994 Y94* probably null Het
Zfp641 T C 15: 98,289,089 N218D probably benign Het
Zscan22 T C 7: 12,904,087 probably null Het
Other mutations in Denr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Denr APN 5 123908119 missense probably benign 0.19
R0007:Denr UTSW 5 123924814 missense probably damaging 1.00
R0007:Denr UTSW 5 123924814 missense probably damaging 1.00
R0025:Denr UTSW 5 123927235 unclassified probably benign
R0567:Denr UTSW 5 123908158 missense probably benign 0.01
R1818:Denr UTSW 5 123917220 missense probably benign 0.00
R5125:Denr UTSW 5 123927081 missense probably damaging 1.00
R6930:Denr UTSW 5 123908187 missense probably benign 0.02
R7657:Denr UTSW 5 123908200 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGCCGTTTGTCTTCACCTGTGTA -3'
(R):5'- CCCGTTAGCACCTCTTTGGCAT -3'

Sequencing Primer
(F):5'- cagcacatagtaggcaccag -3'
(R):5'- AGATATCTGGAAGCTGGGGATG -3'
Posted On2013-04-11