Incidental Mutation 'R0079:Strip2'
ID19605
Institutional Source Beutler Lab
Gene Symbol Strip2
Ensembl Gene ENSMUSG00000039629
Gene Namestriatin interacting protein 2
SynonymsFam40b, D330017J20Rik
MMRRC Submission 038366-MU
Accession Numbers

Genbank: NM_177204.3, NM_001037740.1; Ensembl: ENSMUST00000046028

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0079 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29917012-29959681 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 29920533 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046028] [ENSMUST00000115224] [ENSMUST00000151738]
Predicted Effect probably null
Transcript: ENSMUST00000046028
SMART Domains Protein: ENSMUSP00000036477
Gene: ENSMUSG00000039629

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 822 4.98e-199 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115224
SMART Domains Protein: ENSMUSP00000110879
Gene: ENSMUSG00000039629

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 662 4.85e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137068
Predicted Effect probably null
Transcript: ENSMUST00000151738
SMART Domains Protein: ENSMUSP00000119506
Gene: ENSMUSG00000039629

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 794 1.72e-161 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201689
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency 78% (155/199)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,007,182 T105S possibly damaging Het
Abca13 G A 11: 9,293,493 M1785I probably benign Het
Adamts3 G C 5: 89,693,053 P804A probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ank2 G T 3: 126,934,615 D776E probably benign Het
Cep152 T A 2: 125,618,453 K193M possibly damaging Het
Cep55 C T 19: 38,060,321 L142F probably benign Het
Chd5 A G 4: 152,385,749 Y1884C probably damaging Het
Clasp1 T C 1: 118,543,304 L890P probably damaging Het
Cul9 C A 17: 46,537,663 E716* probably null Het
Cytip T A 2: 58,159,994 D21V probably benign Het
Denr T G 5: 123,924,845 F137C probably damaging Het
Dhrs3 A T 4: 144,920,048 S197C probably damaging Het
Egr4 A T 6: 85,512,769 M103K probably damaging Het
Eif4enif1 C T 11: 3,242,676 Q835* probably null Het
Gckr A G 5: 31,306,539 I268V probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Hpd T C 5: 123,181,481 Y8C probably damaging Het
Il12rb2 A T 6: 67,361,905 F16I probably benign Het
Ildr2 A T 1: 166,307,720 Y347F probably damaging Het
Kcnv1 T C 15: 45,113,333 D186G probably damaging Het
Khdrbs2 A G 1: 32,519,915 probably null Het
L1cam G T X: 73,869,758 P16H probably damaging Het
Lyn A G 4: 3,746,768 H161R probably damaging Het
Mctp2 T A 7: 72,214,116 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mitf A C 6: 97,996,440 M220L probably benign Het
Mrpl21 T C 19: 3,284,807 Y50H possibly damaging Het
Myh1 T A 11: 67,213,411 L968Q probably damaging Het
Myo3b A G 2: 70,095,158 K18E possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp2 T A 7: 5,327,730 T556S possibly damaging Het
Nsmf T C 2: 25,059,084 probably benign Het
Nsun7 C T 5: 66,295,513 P558S probably benign Het
Olfr1168 A T 2: 88,185,354 Y159F possibly damaging Het
Olfr1564 G A 17: 33,216,105 R80C probably benign Het
Olfr394 T G 11: 73,887,737 I212L probably benign Het
Olfr679 T C 7: 105,085,928 S71P probably damaging Het
Papd5 T A 8: 88,200,003 Y14N possibly damaging Het
Phf19 T C 2: 34,895,954 N501S probably benign Het
Ranbp17 A C 11: 33,500,682 I85S probably damaging Het
Robo1 A G 16: 72,933,342 probably benign Het
Sntg1 A G 1: 8,679,062 probably benign Het
Snx15 A G 19: 6,123,913 L58P probably damaging Het
Spink5 G T 18: 43,977,764 C134F probably damaging Het
Taf1d C T 9: 15,309,944 A182V probably benign Het
Tenm3 A G 8: 48,343,345 V475A possibly damaging Het
Tgds A T 14: 118,116,235 H223Q possibly damaging Het
Thoc2 G T X: 41,864,108 S230Y probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Trak2 A T 1: 58,926,724 L97Q probably damaging Het
Trnau1ap A G 4: 132,314,345 Y145H probably damaging Het
Vars2 A T 17: 35,659,156 D780E probably damaging Het
Vmn1r170 T A 7: 23,606,310 S46T possibly damaging Het
Vmn1r20 A T 6: 57,431,792 R34S possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdr64 T C 1: 175,795,102 M805T probably benign Het
Xdh G A 17: 73,891,218 R1225C probably damaging Het
Zfp341 T A 2: 154,624,994 Y94* probably null Het
Zfp641 T C 15: 98,289,089 N218D probably benign Het
Zscan22 T C 7: 12,904,087 probably null Het
Other mutations in Strip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Strip2 APN 6 29931214 missense probably benign 0.04
IGL01357:Strip2 APN 6 29939167 splice site probably benign
IGL01636:Strip2 APN 6 29931193 missense probably benign 0.06
IGL01959:Strip2 APN 6 29928554 missense probably damaging 0.99
IGL01961:Strip2 APN 6 29928427 splice site probably benign
IGL02089:Strip2 APN 6 29917180 unclassified probably benign
1mM(1):Strip2 UTSW 6 29955631 missense probably damaging 1.00
R0331:Strip2 UTSW 6 29926560 missense probably benign 0.44
R0367:Strip2 UTSW 6 29937651 missense possibly damaging 0.90
R0592:Strip2 UTSW 6 29931210 missense probably benign 0.28
R1087:Strip2 UTSW 6 29927634 missense probably damaging 0.99
R1390:Strip2 UTSW 6 29929829 missense probably damaging 1.00
R1758:Strip2 UTSW 6 29941941 critical splice donor site probably null
R2213:Strip2 UTSW 6 29931148 missense probably damaging 0.99
R2437:Strip2 UTSW 6 29941941 critical splice donor site probably null
R2900:Strip2 UTSW 6 29939035 critical splice acceptor site probably null
R3892:Strip2 UTSW 6 29917075 unclassified probably benign
R4010:Strip2 UTSW 6 29955585 missense possibly damaging 0.66
R4435:Strip2 UTSW 6 29925050 missense probably benign 0.06
R4807:Strip2 UTSW 6 29925093 nonsense probably null
R5015:Strip2 UTSW 6 29931266 missense probably benign 0.03
R5080:Strip2 UTSW 6 29945593 missense probably damaging 0.99
R5484:Strip2 UTSW 6 29917155 unclassified probably benign
R5502:Strip2 UTSW 6 29927624 missense probably benign 0.23
R5899:Strip2 UTSW 6 29956958 utr 3 prime probably benign
R6004:Strip2 UTSW 6 29926571 missense probably damaging 0.98
R6479:Strip2 UTSW 6 29944497 splice site probably null
R6835:Strip2 UTSW 6 29941917 missense probably damaging 1.00
R7068:Strip2 UTSW 6 29932208 missense probably benign 0.03
R7073:Strip2 UTSW 6 29941912 missense possibly damaging 0.95
R7088:Strip2 UTSW 6 29920533 critical splice donor site probably null
R7231:Strip2 UTSW 6 29944487 missense probably damaging 0.96
R7399:Strip2 UTSW 6 29927613 missense possibly damaging 0.94
R7813:Strip2 UTSW 6 29923913 critical splice acceptor site probably null
R7827:Strip2 UTSW 6 29923929 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGTCATTGTTTCAGGAATCTTCTCACCC -3'
(R):5'- TGATCTGAGAGCAAATCAGTGCAGC -3'

Sequencing Primer
(F):5'- agaagaatcacattcctgagcc -3'
(R):5'- AGACTGAACAAATGAAGACTACTAAG -3'
Posted On2013-04-11