Incidental Mutation 'R1784:Dnah9'
ID 196051
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Name dynein, axonemal, heavy chain 9
Synonyms D11Ertd686e, Dnahc9
MMRRC Submission 039815-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.400) question?
Stock # R1784 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 65722150-66059379 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65975846 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1401 (T1401I)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000080665
AA Change: T1401I

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: T1401I

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 193 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik T C 16: 64,589,385 (GRCm39) I90V probably damaging Het
Acacb TGGGG TGGG 5: 114,347,828 (GRCm39) probably null Het
Adamts17 C T 7: 66,799,704 (GRCm39) R1060* probably null Het
Adamts5 T A 16: 85,674,803 (GRCm39) K454* probably null Het
Adgrg6 T C 10: 14,315,526 (GRCm39) T593A probably damaging Het
Aldh4a1 A G 4: 139,371,472 (GRCm39) Y462C probably damaging Het
Ankrd12 G T 17: 66,291,071 (GRCm39) P1454Q probably benign Het
Ap1m1 T A 8: 73,006,693 (GRCm39) S230T probably benign Het
Aspm A G 1: 139,401,312 (GRCm39) I1111V probably benign Het
Atp6ap1l T A 13: 91,053,400 (GRCm39) K4N probably damaging Het
Boc T C 16: 44,316,782 (GRCm39) T454A probably benign Het
Bola1 C T 3: 96,104,426 (GRCm39) G56D probably benign Het
C4bp C G 1: 130,570,725 (GRCm39) V284L probably benign Het
Cacna1s T C 1: 136,046,454 (GRCm39) F1761S probably benign Het
Camsap2 C T 1: 136,209,053 (GRCm39) R802Q probably benign Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Cbs G T 17: 31,839,923 (GRCm39) A337E probably benign Het
Ccdc186 A C 19: 56,797,652 (GRCm39) H306Q probably benign Het
Cd180 T C 13: 102,842,367 (GRCm39) L471P probably damaging Het
Cd55 C A 1: 130,387,370 (GRCm39) A143S probably benign Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cdk12 T C 11: 98,140,796 (GRCm39) probably benign Het
Cfh C T 1: 140,075,435 (GRCm39) V268I possibly damaging Het
Cfhr2 A G 1: 139,741,180 (GRCm39) M265T probably benign Het
Cfhr2 A C 1: 139,741,197 (GRCm39) N259K probably benign Het
Chi3l1 C T 1: 134,116,267 (GRCm39) A250V probably damaging Het
Chit1 A G 1: 134,077,132 (GRCm39) R312G possibly damaging Het
Chrna6 A T 8: 27,896,812 (GRCm39) M355K possibly damaging Het
Clcn1 T A 6: 42,276,448 (GRCm39) F360Y possibly damaging Het
Copa T A 1: 171,939,554 (GRCm39) F597Y probably benign Het
Crb1 G A 1: 139,168,876 (GRCm39) P881S probably damaging Het
Crb1 C T 1: 139,170,733 (GRCm39) G825R probably damaging Het
Crb1 C T 1: 139,171,155 (GRCm39) R684H probably benign Het
Crb1 T C 1: 139,162,517 (GRCm39) M1214V probably benign Het
Crb1 A T 1: 139,165,360 (GRCm39) H921Q probably benign Het
Crybg1 T A 10: 43,880,015 (GRCm39) Q391L probably damaging Het
Cwh43 T C 5: 73,565,561 (GRCm39) L42P probably damaging Het
Cxcr4 C T 1: 128,517,014 (GRCm39) V216I probably benign Het
Cyb5r1 C T 1: 134,335,405 (GRCm39) R147W probably damaging Het
Ddx59 T C 1: 136,344,791 (GRCm39) V154A probably benign Het
Dnah17 C T 11: 117,960,345 (GRCm39) C2572Y possibly damaging Het
Dstyk C T 1: 132,384,722 (GRCm39) L739F probably damaging Het
Elf2 A T 3: 51,164,993 (GRCm39) V277D probably damaging Het
Etnk2 C A 1: 133,293,325 (GRCm39) D89E probably benign Het
Etnk2 G T 1: 133,293,503 (GRCm39) G149W probably damaging Het
Etnk2 C T 1: 133,293,554 (GRCm39) R166* probably null Het
Etnk2 G A 1: 133,293,555 (GRCm39) R166Q probably benign Het
Etnk2 T A 1: 133,304,653 (GRCm39) V292E probably benign Het
Etnk2 G T 1: 133,304,784 (GRCm39) A336S probably benign Het
Etnk2 C T 1: 133,291,628 (GRCm39) P43S probably benign Het
Fam72a C T 1: 131,466,633 (GRCm39) T139M probably benign Het
Fam72a T C 1: 131,458,406 (GRCm39) I56T probably benign Het
Fat3 A C 9: 15,907,611 (GRCm39) V2797G possibly damaging Het
Fbxl6 C T 15: 76,422,258 (GRCm39) R137H probably damaging Het
Fcamr A G 1: 130,739,317 (GRCm39) I206V probably benign Het
Fcamr G A 1: 130,740,366 (GRCm39) G262S probably benign Het
Fcamr A G 1: 130,740,429 (GRCm39) I283V probably benign Het
Fcamr T C 1: 130,740,475 (GRCm39) V298A probably benign Het
Fcamr A G 1: 130,740,546 (GRCm39) M322V probably benign Het
Fcamr C T 1: 130,740,553 (GRCm39) P324L probably benign Het
Fcamr A G 1: 130,742,334 (GRCm39) N574D probably benign Het
Fcamr A C 1: 130,732,364 (GRCm39) N117T probably benign Het
Fcmr T C 1: 130,806,006 (GRCm39) S321P probably benign Het
Fcmr A G 1: 130,803,711 (GRCm39) T172A probably benign Het
Gabarap C T 11: 69,882,515 (GRCm39) probably benign Het
Galnt17 A T 5: 131,179,801 (GRCm39) H115Q probably benign Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Glrx2 C T 1: 143,615,478 (GRCm39) A27V possibly damaging Het
Gm10563 C T 4: 155,720,337 (GRCm39) probably benign Het
Gm12887 T A 4: 121,473,715 (GRCm39) D45V probably benign Het
Gse1 G A 8: 121,294,992 (GRCm39) probably benign Het
Guk1 A T 11: 59,076,138 (GRCm39) V100E probably damaging Het
Heatr4 T C 12: 84,014,346 (GRCm39) I630M probably benign Het
Hectd4 A T 5: 121,439,902 (GRCm39) Y1134F possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Igfn1 G A 1: 135,887,666 (GRCm39) P2466L probably damaging Het
Igfn1 T C 1: 135,926,421 (GRCm39) I10V unknown Het
Igfn1 T C 1: 135,926,363 (GRCm39) E29G probably benign Het
Igfn1 G A 1: 135,910,213 (GRCm39) R124W probably benign Het
Igfn1 C T 1: 135,907,653 (GRCm39) A231T probably benign Het
Igfn1 C T 1: 135,899,865 (GRCm39) R482Q probably benign Het
Igfn1 T C 1: 135,898,149 (GRCm39) S806G probably benign Het
Igfn1 G A 1: 135,895,937 (GRCm39) A1543V probably benign Het
Ikbke C A 1: 131,193,674 (GRCm39) A459S probably benign Het
Ikbke T C 1: 131,197,560 (GRCm39) S447G probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Itprid1 T C 6: 55,945,526 (GRCm39) F749S probably benign Het
Kcnh5 T C 12: 75,184,465 (GRCm39) D86G probably benign Het
Kcnt2 G A 1: 140,282,285 (GRCm39) S90N probably benign Het
Kif14 A G 1: 136,396,017 (GRCm39) N108D probably benign Het
Kif14 T C 1: 136,453,521 (GRCm39) V1433A probably benign Het
Kif14 T C 1: 136,443,699 (GRCm39) F1291L probably benign Het
Kif14 C T 1: 136,431,169 (GRCm39) L1189F probably benign Het
Kif14 A G 1: 136,418,070 (GRCm39) S868G probably benign Het
Kif14 G A 1: 136,406,103 (GRCm39) A556T probably benign Het
Kif14 A G 1: 136,396,713 (GRCm39) K340E probably damaging Het
Kif18b A G 11: 102,806,367 (GRCm39) probably null Het
Kif21b A G 1: 136,087,859 (GRCm39) I983V possibly damaging Het
Kpna3 T A 14: 61,605,150 (GRCm39) E499V probably benign Het
Kremen1 GGG GGGTGG 11: 5,151,792 (GRCm39) probably benign Het
Krt23 A T 11: 99,383,790 (GRCm39) V34D probably damaging Het
Lad1 C T 1: 135,755,119 (GRCm39) P132S possibly damaging Het
Lad1 C T 1: 135,755,761 (GRCm39) R346C probably damaging Het
Lax1 G A 1: 133,611,372 (GRCm39) P67S probably damaging Het
Lax1 T C 1: 133,607,716 (GRCm39) R342G probably benign Het
Lax1 T C 1: 133,608,307 (GRCm39) N145D probably benign Het
Lgr6 C T 1: 134,931,214 (GRCm39) S3N probably benign Het
Lgr6 G T 1: 134,918,373 (GRCm39) H263N probably benign Het
Lgr6 A T 1: 134,915,747 (GRCm39) S334T probably benign Het
Lgr6 C T 1: 134,914,826 (GRCm39) V641I probably benign Het
Lima1 G T 15: 99,678,344 (GRCm39) P539Q possibly damaging Het
Lmod1 C T 1: 135,291,811 (GRCm39) T222I probably benign Het
Megf10 T C 18: 57,373,864 (GRCm39) probably null Het
Mrgbp T A 2: 180,227,242 (GRCm39) N192K probably damaging Het
Mrgpra2b A G 7: 47,114,627 (GRCm39) I35T probably benign Het
Mroh3 G C 1: 136,119,882 (GRCm39) Q440E possibly damaging Het
Mrpl3 C T 9: 104,934,266 (GRCm39) H130Y probably benign Het
Mybph C T 1: 134,125,218 (GRCm39) R249C probably benign Het
Mycbp2 A T 14: 103,392,614 (GRCm39) C3206S probably damaging Het
Nav1 A T 1: 135,512,465 (GRCm39) D198E possibly damaging Het
Nbeal2 T A 9: 110,459,925 (GRCm39) K1844* probably null Het
Ndufaf7 A T 17: 79,245,058 (GRCm39) K59M probably damaging Het
Nr5a2 C A 1: 136,879,863 (GRCm39) R35L probably benign Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Optc C G 1: 133,832,908 (GRCm39) S64T probably benign Het
Or2f1 C A 6: 42,721,069 (GRCm39) L33M possibly damaging Het
Or8b12i A T 9: 20,082,209 (GRCm39) Y219* probably null Het
Otoa T C 7: 120,724,662 (GRCm39) V447A probably benign Het
Papss1 A G 3: 131,311,728 (GRCm39) N319D probably benign Het
Pcdhb3 G A 18: 37,434,931 (GRCm39) G299D probably damaging Het
Pcsk4 T C 10: 80,159,404 (GRCm39) D432G probably damaging Het
Pde4b T C 4: 102,462,457 (GRCm39) I711T probably benign Het
Pde5a G T 3: 122,541,889 (GRCm39) L126F probably damaging Het
Pigr C T 1: 130,772,259 (GRCm39) A159V possibly damaging Het
Pik3c2b C T 1: 132,994,365 (GRCm39) P110S probably benign Het
Pinx1 A G 14: 64,115,559 (GRCm39) probably null Het
Plekha6 C G 1: 133,215,584 (GRCm39) T792S probably benign Het
Ppfia4 G A 1: 134,227,059 (GRCm39) P1159S probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Prrx1 T A 1: 163,089,536 (GRCm39) N97I probably damaging Het
Ptpn7 A G 1: 135,062,213 (GRCm39) Q53R probably benign Het
Ptprc A G 1: 138,035,561 (GRCm39) S405P probably benign Het
Ptprc T G 1: 138,027,414 (GRCm39) N478T probably benign Het
Ptprc T C 1: 138,039,992 (GRCm39) K212E possibly damaging Het
Ptprc A G 1: 138,035,575 (GRCm39) V400A probably benign Het
Ptprc C A 1: 138,035,562 (GRCm39) E402D probably benign Het
Rab29 A G 1: 131,799,848 (GRCm39) Q141R probably benign Het
Rbsn A T 6: 92,167,000 (GRCm39) L548Q possibly damaging Het
Ren1 C G 1: 133,287,745 (GRCm39) L360V probably benign Het
Ren1 A T 1: 133,287,721 (GRCm39) N352Y probably benign Het
Ren1 A T 1: 133,286,817 (GRCm39) E315D probably benign Het
Ren1 A C 1: 133,284,195 (GRCm39) K187Q probably benign Het
Ren1 C T 1: 133,281,975 (GRCm39) T32I probably benign Het
Ren1 T A 1: 133,281,944 (GRCm39) W22R probably damaging Het
Ren1 C G 1: 133,278,516 (GRCm39) probably null Het
Rgs22 T A 15: 36,087,582 (GRCm39) K445N probably damaging Het
Rint1 T A 5: 24,014,841 (GRCm39) D352E probably benign Het
Rnpep C T 1: 135,190,834 (GRCm39) A571T possibly damaging Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ro60 C T 1: 143,635,752 (GRCm39) V465I probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Sis A T 3: 72,872,978 (GRCm39) C53* probably null Het
Slain2 A G 5: 73,114,957 (GRCm39) H396R probably damaging Het
Slc22a5 G A 11: 53,757,177 (GRCm39) P491L probably damaging Het
Slc26a9 C T 1: 131,691,608 (GRCm39) A617V probably benign Het
Slc26a9 C A 1: 131,693,750 (GRCm39) R747S probably benign Het
Stab2 T G 10: 86,773,903 (GRCm39) R809S probably benign Het
Tbc1d19 T G 5: 53,986,714 (GRCm39) I41S probably damaging Het
Tbc1d31 T A 15: 57,827,316 (GRCm39) H919Q possibly damaging Het
Thsd7b G C 1: 129,605,920 (GRCm39) A554P probably benign Het
Thsd7b A C 1: 130,044,368 (GRCm39) Q1116P probably benign Het
Thsd7b C T 1: 129,556,628 (GRCm39) T328I probably damaging Het
Thsd7b T A 1: 129,595,674 (GRCm39) F498Y probably benign Het
Tnfrsf25 T A 4: 152,202,761 (GRCm39) probably null Het
Tnnt2 C T 1: 135,773,244 (GRCm39) probably benign Het
Traf7 A G 17: 24,731,353 (GRCm39) F228L probably damaging Het
Trim32 T A 4: 65,532,634 (GRCm39) I397N probably damaging Het
Tubgcp2 T C 7: 139,577,968 (GRCm39) T779A probably benign Het
Ube2t C T 1: 134,899,905 (GRCm39) A149V probably benign Het
Upf2 A T 2: 6,032,261 (GRCm39) S191C probably damaging Het
Usp42 T C 5: 143,700,381 (GRCm39) D1214G probably damaging Het
Vcam1 T A 3: 115,908,164 (GRCm39) I633L probably benign Het
Vmn2r73 T C 7: 85,507,086 (GRCm39) Y742C probably damaging Het
Vmn2r81 C A 10: 79,106,489 (GRCm39) T489K probably benign Het
Ypel1 C G 16: 16,907,283 (GRCm39) probably benign Het
Zc3h11a C T 1: 133,552,359 (GRCm39) V583I probably benign Het
Zc3h11a G A 1: 133,549,892 (GRCm39) P695S probably benign Het
Zfp169 C T 13: 48,643,295 (GRCm39) A611T possibly damaging Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,553,091 (GRCm39) probably benign Het
Zp3r A G 1: 130,524,551 (GRCm39) L164P probably benign Het
Zp3r C A 1: 130,547,151 (GRCm39) E8D possibly damaging Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65,732,064 (GRCm39) splice site probably benign
IGL00805:Dnah9 APN 11 65,772,521 (GRCm39) missense probably benign 0.00
IGL00826:Dnah9 APN 11 65,880,768 (GRCm39) missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65,740,806 (GRCm39) missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 65,962,882 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah9 APN 11 65,971,397 (GRCm39) missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66,046,285 (GRCm39) missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65,846,543 (GRCm39) missense probably benign 0.14
IGL01537:Dnah9 APN 11 65,838,506 (GRCm39) missense probably benign
IGL01565:Dnah9 APN 11 65,924,655 (GRCm39) missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66,009,656 (GRCm39) missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65,722,441 (GRCm39) nonsense probably null
IGL01625:Dnah9 APN 11 65,935,471 (GRCm39) missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66,009,655 (GRCm39) missense probably damaging 1.00
IGL01819:Dnah9 APN 11 65,998,952 (GRCm39) missense probably benign 0.33
IGL01896:Dnah9 APN 11 66,021,492 (GRCm39) missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 65,965,860 (GRCm39) splice site probably benign
IGL01923:Dnah9 APN 11 66,016,061 (GRCm39) splice site probably benign
IGL02059:Dnah9 APN 11 65,963,784 (GRCm39) missense probably damaging 1.00
IGL02068:Dnah9 APN 11 65,951,871 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66,008,318 (GRCm39) missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65,818,526 (GRCm39) missense probably damaging 1.00
IGL02264:Dnah9 APN 11 65,971,314 (GRCm39) splice site probably benign
IGL02325:Dnah9 APN 11 65,725,043 (GRCm39) missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66,015,979 (GRCm39) missense probably benign
IGL02440:Dnah9 APN 11 65,846,072 (GRCm39) missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65,838,444 (GRCm39) nonsense probably null
IGL02496:Dnah9 APN 11 65,920,189 (GRCm39) missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65,818,427 (GRCm39) missense probably benign 0.02
IGL02718:Dnah9 APN 11 65,777,466 (GRCm39) missense probably damaging 0.99
IGL02832:Dnah9 APN 11 65,931,172 (GRCm39) missense probably damaging 1.00
IGL02851:Dnah9 APN 11 65,928,570 (GRCm39) splice site probably benign
IGL02859:Dnah9 APN 11 65,772,445 (GRCm39) splice site probably benign
IGL02864:Dnah9 APN 11 65,951,829 (GRCm39) missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66,009,793 (GRCm39) missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65,732,099 (GRCm39) missense probably benign 0.23
IGL02987:Dnah9 APN 11 65,746,098 (GRCm39) missense probably damaging 0.98
IGL03160:Dnah9 APN 11 65,998,880 (GRCm39) missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65,872,067 (GRCm39) missense probably benign 0.13
IGL03180:Dnah9 APN 11 65,777,465 (GRCm39) missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65,838,368 (GRCm39) missense probably damaging 1.00
anarchy UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
sacco UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
Tweed UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
vanzetti UTSW 11 65,746,198 (GRCm39) nonsense probably null
IGL02837:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 65,895,839 (GRCm39) missense probably benign 0.44
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0070:Dnah9 UTSW 11 66,050,866 (GRCm39) missense probably benign 0.10
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0180:Dnah9 UTSW 11 66,038,116 (GRCm39) missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R0230:Dnah9 UTSW 11 65,746,141 (GRCm39) missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65,802,678 (GRCm39) missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65,802,615 (GRCm39) critical splice donor site probably null
R0288:Dnah9 UTSW 11 65,915,960 (GRCm39) critical splice donor site probably null
R0309:Dnah9 UTSW 11 65,917,798 (GRCm39) splice site probably benign
R0356:Dnah9 UTSW 11 66,021,388 (GRCm39) critical splice donor site probably null
R0403:Dnah9 UTSW 11 65,975,615 (GRCm39) missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 65,998,961 (GRCm39) missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65,809,539 (GRCm39) splice site probably benign
R0496:Dnah9 UTSW 11 65,965,961 (GRCm39) missense probably null 1.00
R0557:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65,881,315 (GRCm39) missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66,009,703 (GRCm39) missense probably benign 0.02
R0599:Dnah9 UTSW 11 65,856,515 (GRCm39) missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65,732,159 (GRCm39) missense probably damaging 1.00
R0666:Dnah9 UTSW 11 65,976,284 (GRCm39) missense probably benign 0.01
R0715:Dnah9 UTSW 11 65,972,074 (GRCm39) splice site probably benign
R0726:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R0737:Dnah9 UTSW 11 65,998,724 (GRCm39) missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66,046,356 (GRCm39) missense probably benign 0.30
R0792:Dnah9 UTSW 11 65,786,827 (GRCm39) missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 65,896,002 (GRCm39) missense probably benign 0.00
R0973:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R0974:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R1055:Dnah9 UTSW 11 66,050,837 (GRCm39) missense probably damaging 1.00
R1081:Dnah9 UTSW 11 65,975,703 (GRCm39) missense probably damaging 0.99
R1184:Dnah9 UTSW 11 65,975,438 (GRCm39) critical splice donor site probably null
R1225:Dnah9 UTSW 11 65,761,886 (GRCm39) missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65,818,414 (GRCm39) missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65,846,573 (GRCm39) missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65,764,958 (GRCm39) missense probably benign 0.22
R1447:Dnah9 UTSW 11 65,999,308 (GRCm39) missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65,818,612 (GRCm39) missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1486:Dnah9 UTSW 11 65,725,098 (GRCm39) missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65,772,587 (GRCm39) missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66,003,156 (GRCm39) missense probably benign
R1617:Dnah9 UTSW 11 65,786,747 (GRCm39) missense probably damaging 1.00
R1623:Dnah9 UTSW 11 65,928,463 (GRCm39) missense probably damaging 1.00
R1626:Dnah9 UTSW 11 65,976,093 (GRCm39) missense probably benign 0.05
R1671:Dnah9 UTSW 11 65,818,789 (GRCm39) missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65,845,650 (GRCm39) nonsense probably null
R1701:Dnah9 UTSW 11 65,802,750 (GRCm39) missense probably damaging 1.00
R1702:Dnah9 UTSW 11 65,976,021 (GRCm39) missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65,805,980 (GRCm39) missense probably benign 0.11
R1718:Dnah9 UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65,872,048 (GRCm39) missense probably benign 0.31
R1793:Dnah9 UTSW 11 66,010,420 (GRCm39) critical splice donor site probably null
R1801:Dnah9 UTSW 11 65,846,123 (GRCm39) missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65,740,887 (GRCm39) missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66,009,667 (GRCm39) missense probably benign 0.10
R1840:Dnah9 UTSW 11 65,725,024 (GRCm39) nonsense probably null
R1847:Dnah9 UTSW 11 65,725,212 (GRCm39) missense probably damaging 1.00
R1872:Dnah9 UTSW 11 65,928,316 (GRCm39) missense probably benign 0.16
R1929:Dnah9 UTSW 11 65,867,224 (GRCm39) missense probably benign 0.05
R1969:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65,846,164 (GRCm39) missense probably benign 0.11
R2049:Dnah9 UTSW 11 65,935,509 (GRCm39) missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66,036,261 (GRCm39) missense probably benign 0.31
R2104:Dnah9 UTSW 11 65,951,950 (GRCm39) missense probably damaging 1.00
R2109:Dnah9 UTSW 11 65,928,411 (GRCm39) missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66,008,309 (GRCm39) missense probably damaging 1.00
R2172:Dnah9 UTSW 11 65,963,605 (GRCm39) missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65,750,325 (GRCm39) missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2272:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2396:Dnah9 UTSW 11 65,975,984 (GRCm39) missense probably benign 0.01
R2398:Dnah9 UTSW 11 65,806,029 (GRCm39) missense probably damaging 1.00
R2418:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2419:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2510:Dnah9 UTSW 11 65,895,995 (GRCm39) missense probably damaging 1.00
R2680:Dnah9 UTSW 11 65,924,751 (GRCm39) missense probably benign 0.00
R2875:Dnah9 UTSW 11 66,059,287 (GRCm39) missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66,008,414 (GRCm39) missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3237:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3433:Dnah9 UTSW 11 65,965,938 (GRCm39) missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66,047,734 (GRCm39) nonsense probably null
R3820:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3821:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3822:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3861:Dnah9 UTSW 11 65,943,820 (GRCm39) splice site probably benign
R3918:Dnah9 UTSW 11 65,761,800 (GRCm39) missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65,725,290 (GRCm39) missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66,024,461 (GRCm39) missense probably benign 0.03
R4072:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4076:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4097:Dnah9 UTSW 11 65,881,285 (GRCm39) missense probably damaging 1.00
R4409:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65,872,040 (GRCm39) missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66,009,575 (GRCm39) missense probably benign 0.00
R4434:Dnah9 UTSW 11 65,998,901 (GRCm39) missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65,772,467 (GRCm39) missense probably benign 0.07
R4452:Dnah9 UTSW 11 65,917,908 (GRCm39) missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66,038,215 (GRCm39) missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4590:Dnah9 UTSW 11 65,931,218 (GRCm39) missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66,058,978 (GRCm39) missense probably benign
R4655:Dnah9 UTSW 11 65,846,558 (GRCm39) missense probably benign 0.00
R4667:Dnah9 UTSW 11 66,046,357 (GRCm39) missense probably benign
R4718:Dnah9 UTSW 11 65,976,299 (GRCm39) missense probably benign
R4720:Dnah9 UTSW 11 65,967,184 (GRCm39) missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65,818,552 (GRCm39) missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65,764,950 (GRCm39) nonsense probably null
R4963:Dnah9 UTSW 11 65,975,437 (GRCm39) splice site probably null
R5074:Dnah9 UTSW 11 65,740,866 (GRCm39) missense probably damaging 1.00
R5230:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66,003,159 (GRCm39) missense probably benign 0.34
R5364:Dnah9 UTSW 11 65,772,522 (GRCm39) missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 65,920,180 (GRCm39) missense probably damaging 1.00
R5386:Dnah9 UTSW 11 65,920,182 (GRCm39) missense probably damaging 1.00
R5389:Dnah9 UTSW 11 65,986,140 (GRCm39) nonsense probably null
R5541:Dnah9 UTSW 11 66,036,162 (GRCm39) missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65,772,566 (GRCm39) missense probably benign 0.00
R5576:Dnah9 UTSW 11 65,724,922 (GRCm39) splice site probably null
R5648:Dnah9 UTSW 11 65,818,581 (GRCm39) missense probably benign 0.00
R5653:Dnah9 UTSW 11 65,740,806 (GRCm39) missense probably damaging 0.99
R5713:Dnah9 UTSW 11 65,916,049 (GRCm39) missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65,846,065 (GRCm39) missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66,017,427 (GRCm39) missense probably benign 0.01
R5831:Dnah9 UTSW 11 65,998,947 (GRCm39) missense probably benign 0.00
R5847:Dnah9 UTSW 11 65,986,066 (GRCm39) frame shift probably null
R5870:Dnah9 UTSW 11 65,976,036 (GRCm39) missense probably benign 0.01
R5902:Dnah9 UTSW 11 65,916,013 (GRCm39) missense probably benign 0.08
R5918:Dnah9 UTSW 11 65,725,025 (GRCm39) missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65,725,307 (GRCm39) missense probably damaging 1.00
R6065:Dnah9 UTSW 11 66,036,223 (GRCm39) missense possibly damaging 0.65
R6065:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.05
R6086:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
R6086:Dnah9 UTSW 11 65,880,741 (GRCm39) missense probably damaging 0.99
R6102:Dnah9 UTSW 11 65,881,342 (GRCm39) missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66,038,225 (GRCm39) missense probably benign
R6154:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.00
R6262:Dnah9 UTSW 11 65,772,631 (GRCm39) splice site probably null
R6265:Dnah9 UTSW 11 66,058,920 (GRCm39) missense probably benign 0.04
R6290:Dnah9 UTSW 11 65,732,201 (GRCm39) missense probably damaging 1.00
R6345:Dnah9 UTSW 11 65,928,519 (GRCm39) missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66,059,107 (GRCm39) missense probably benign 0.37
R6582:Dnah9 UTSW 11 65,951,923 (GRCm39) missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65,846,192 (GRCm39) missense probably damaging 1.00
R6800:Dnah9 UTSW 11 65,963,565 (GRCm39) critical splice donor site probably null
R6812:Dnah9 UTSW 11 65,872,155 (GRCm39) missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66,008,452 (GRCm39) missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 65,975,975 (GRCm39) missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 65,967,167 (GRCm39) missense probably damaging 1.00
R6977:Dnah9 UTSW 11 65,998,735 (GRCm39) missense probably benign 0.37
R7021:Dnah9 UTSW 11 65,872,057 (GRCm39) missense probably benign
R7161:Dnah9 UTSW 11 65,746,198 (GRCm39) nonsense probably null
R7175:Dnah9 UTSW 11 66,024,463 (GRCm39) missense probably benign 0.03
R7199:Dnah9 UTSW 11 66,009,770 (GRCm39) missense probably benign 0.04
R7231:Dnah9 UTSW 11 65,856,473 (GRCm39) missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65,881,302 (GRCm39) missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65,880,677 (GRCm39) missense probably benign 0.00
R7350:Dnah9 UTSW 11 65,971,404 (GRCm39) missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66,008,233 (GRCm39) critical splice donor site probably null
R7427:Dnah9 UTSW 11 65,846,045 (GRCm39) missense probably benign
R7477:Dnah9 UTSW 11 65,883,557 (GRCm39) missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65,732,240 (GRCm39) missense probably benign 0.01
R7521:Dnah9 UTSW 11 65,880,663 (GRCm39) missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66,016,041 (GRCm39) missense probably benign 0.43
R7659:Dnah9 UTSW 11 65,880,606 (GRCm39) missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66,009,784 (GRCm39) missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65,802,656 (GRCm39) missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65,740,839 (GRCm39) missense probably damaging 1.00
R7808:Dnah9 UTSW 11 65,896,631 (GRCm39) nonsense probably null
R7814:Dnah9 UTSW 11 65,896,486 (GRCm39) missense probably damaging 1.00
R7818:Dnah9 UTSW 11 65,916,037 (GRCm39) missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65,732,227 (GRCm39) missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 65,908,201 (GRCm39) missense probably benign 0.02
R8232:Dnah9 UTSW 11 65,746,149 (GRCm39) missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65,880,644 (GRCm39) missense probably benign 0.00
R8326:Dnah9 UTSW 11 66,008,452 (GRCm39) missense probably benign 0.01
R8338:Dnah9 UTSW 11 65,732,067 (GRCm39) critical splice donor site probably null
R8356:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65,722,556 (GRCm39) missense probably benign 0.00
R8721:Dnah9 UTSW 11 65,986,124 (GRCm39) missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65,818,816 (GRCm39) missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65,796,057 (GRCm39) missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65,750,309 (GRCm39) missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65,740,742 (GRCm39) missense probably benign 0.13
R8837:Dnah9 UTSW 11 65,746,060 (GRCm39) missense possibly damaging 0.72
R8886:Dnah9 UTSW 11 65,943,840 (GRCm39) missense probably damaging 1.00
R8887:Dnah9 UTSW 11 65,746,210 (GRCm39) missense probably benign 0.01
R8921:Dnah9 UTSW 11 65,802,747 (GRCm39) missense probably benign
R8933:Dnah9 UTSW 11 65,746,078 (GRCm39) missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66,059,226 (GRCm39) missense possibly damaging 0.91
R8967:Dnah9 UTSW 11 66,015,938 (GRCm39) critical splice donor site probably null
R8979:Dnah9 UTSW 11 65,895,978 (GRCm39) missense probably benign
R8991:Dnah9 UTSW 11 65,777,506 (GRCm39) missense probably damaging 0.96
R9016:Dnah9 UTSW 11 65,998,856 (GRCm39) missense probably damaging 0.99
R9025:Dnah9 UTSW 11 65,896,651 (GRCm39) missense probably damaging 1.00
R9043:Dnah9 UTSW 11 65,845,680 (GRCm39) missense
R9047:Dnah9 UTSW 11 65,962,925 (GRCm39) missense possibly damaging 0.89
R9076:Dnah9 UTSW 11 66,008,464 (GRCm39) missense probably benign 0.21
R9113:Dnah9 UTSW 11 65,880,713 (GRCm39) missense probably damaging 1.00
R9152:Dnah9 UTSW 11 66,021,457 (GRCm39) missense probably damaging 1.00
R9187:Dnah9 UTSW 11 65,895,972 (GRCm39) missense probably benign
R9198:Dnah9 UTSW 11 65,846,570 (GRCm39) missense probably benign 0.02
R9203:Dnah9 UTSW 11 65,746,113 (GRCm39) missense possibly damaging 0.58
R9234:Dnah9 UTSW 11 65,924,751 (GRCm39) missense possibly damaging 0.68
R9245:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R9265:Dnah9 UTSW 11 65,732,081 (GRCm39) missense probably benign 0.01
R9307:Dnah9 UTSW 11 65,976,300 (GRCm39) missense probably benign 0.14
R9336:Dnah9 UTSW 11 65,761,775 (GRCm39) missense probably damaging 1.00
R9386:Dnah9 UTSW 11 65,838,368 (GRCm39) missense probably damaging 1.00
R9498:Dnah9 UTSW 11 65,739,199 (GRCm39) missense probably damaging 0.99
R9508:Dnah9 UTSW 11 65,725,089 (GRCm39) missense probably damaging 1.00
R9524:Dnah9 UTSW 11 65,976,309 (GRCm39) missense possibly damaging 0.92
R9577:Dnah9 UTSW 11 65,867,347 (GRCm39) missense probably benign 0.00
R9583:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R9587:Dnah9 UTSW 11 65,999,217 (GRCm39) missense probably null 0.92
R9612:Dnah9 UTSW 11 65,818,475 (GRCm39) missense probably benign 0.00
R9748:Dnah9 UTSW 11 65,976,290 (GRCm39) missense possibly damaging 0.51
R9749:Dnah9 UTSW 11 65,986,202 (GRCm39) missense probably damaging 1.00
R9759:Dnah9 UTSW 11 65,965,944 (GRCm39) missense probably null 0.93
R9784:Dnah9 UTSW 11 65,975,960 (GRCm39) missense probably damaging 0.99
V3553:Dnah9 UTSW 11 65,860,902 (GRCm39) missense probably damaging 1.00
X0027:Dnah9 UTSW 11 65,976,305 (GRCm39) missense probably benign 0.07
X0028:Dnah9 UTSW 11 65,881,278 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,860,910 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,818,679 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,786,798 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,963,661 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,928,300 (GRCm39) missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66,017,476 (GRCm39) missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1186:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGATAGAGATGACCGAGTCAGC -3'
(R):5'- GCACATCCGCAACCTAGATAAGGAG -3'

Sequencing Primer
(F):5'- CATCAGGTTCTGAAGTTGCAC -3'
(R):5'- CAACCTAGATAAGGAGTTCAGGTCC -3'
Posted On 2014-05-23