Incidental Mutation 'R0079:Il12rb2'
ID19607
Institutional Source Beutler Lab
Gene Symbol Il12rb2
Ensembl Gene ENSMUSG00000018341
Gene Nameinterleukin 12 receptor, beta 2
SynonymsIL-12RB2, Ifnm, A930027I18Rik
MMRRC Submission 038366-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0079 (G1)
Quality Score201
Status Validated
Chromosome6
Chromosomal Location67291318-67376188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67361905 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 16 (F16I)
Ref Sequence ENSEMBL: ENSMUSP00000010605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018485]
Predicted Effect probably benign
Transcript: ENSMUST00000018485
AA Change: F16I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341
AA Change: F16I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Lep_receptor_Ig 28 120 6.4e-20 PFAM
FN3 137 225 2.41e0 SMART
FN3 240 320 3.4e-4 SMART
Blast:FN3 340 434 2e-40 BLAST
FN3 436 525 3.17e-4 SMART
FN3 534 622 6.45e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency 78% (155/199)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,007,182 T105S possibly damaging Het
Abca13 G A 11: 9,293,493 M1785I probably benign Het
Adamts3 G C 5: 89,693,053 P804A probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ank2 G T 3: 126,934,615 D776E probably benign Het
Cep152 T A 2: 125,618,453 K193M possibly damaging Het
Cep55 C T 19: 38,060,321 L142F probably benign Het
Chd5 A G 4: 152,385,749 Y1884C probably damaging Het
Clasp1 T C 1: 118,543,304 L890P probably damaging Het
Cul9 C A 17: 46,537,663 E716* probably null Het
Cytip T A 2: 58,159,994 D21V probably benign Het
Denr T G 5: 123,924,845 F137C probably damaging Het
Dhrs3 A T 4: 144,920,048 S197C probably damaging Het
Egr4 A T 6: 85,512,769 M103K probably damaging Het
Eif4enif1 C T 11: 3,242,676 Q835* probably null Het
Gckr A G 5: 31,306,539 I268V probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Hpd T C 5: 123,181,481 Y8C probably damaging Het
Ildr2 A T 1: 166,307,720 Y347F probably damaging Het
Kcnv1 T C 15: 45,113,333 D186G probably damaging Het
Khdrbs2 A G 1: 32,519,915 probably null Het
L1cam G T X: 73,869,758 P16H probably damaging Het
Lyn A G 4: 3,746,768 H161R probably damaging Het
Mctp2 T A 7: 72,214,116 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mitf A C 6: 97,996,440 M220L probably benign Het
Mrpl21 T C 19: 3,284,807 Y50H possibly damaging Het
Myh1 T A 11: 67,213,411 L968Q probably damaging Het
Myo3b A G 2: 70,095,158 K18E possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp2 T A 7: 5,327,730 T556S possibly damaging Het
Nsmf T C 2: 25,059,084 probably benign Het
Nsun7 C T 5: 66,295,513 P558S probably benign Het
Olfr1168 A T 2: 88,185,354 Y159F possibly damaging Het
Olfr1564 G A 17: 33,216,105 R80C probably benign Het
Olfr394 T G 11: 73,887,737 I212L probably benign Het
Olfr679 T C 7: 105,085,928 S71P probably damaging Het
Papd5 T A 8: 88,200,003 Y14N possibly damaging Het
Phf19 T C 2: 34,895,954 N501S probably benign Het
Ranbp17 A C 11: 33,500,682 I85S probably damaging Het
Robo1 A G 16: 72,933,342 probably benign Het
Sntg1 A G 1: 8,679,062 probably benign Het
Snx15 A G 19: 6,123,913 L58P probably damaging Het
Spink5 G T 18: 43,977,764 C134F probably damaging Het
Strip2 T C 6: 29,920,533 probably null Het
Taf1d C T 9: 15,309,944 A182V probably benign Het
Tenm3 A G 8: 48,343,345 V475A possibly damaging Het
Tgds A T 14: 118,116,235 H223Q possibly damaging Het
Thoc2 G T X: 41,864,108 S230Y probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Trak2 A T 1: 58,926,724 L97Q probably damaging Het
Trnau1ap A G 4: 132,314,345 Y145H probably damaging Het
Vars2 A T 17: 35,659,156 D780E probably damaging Het
Vmn1r170 T A 7: 23,606,310 S46T possibly damaging Het
Vmn1r20 A T 6: 57,431,792 R34S possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdr64 T C 1: 175,795,102 M805T probably benign Het
Xdh G A 17: 73,891,218 R1225C probably damaging Het
Zfp341 T A 2: 154,624,994 Y94* probably null Het
Zfp641 T C 15: 98,289,089 N218D probably benign Het
Zscan22 T C 7: 12,904,087 probably null Het
Other mutations in Il12rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Il12rb2 APN 6 67357692 missense probably damaging 0.98
IGL00767:Il12rb2 APN 6 67303562 missense possibly damaging 0.63
IGL00835:Il12rb2 APN 6 67360567 missense probably damaging 0.99
IGL00864:Il12rb2 APN 6 67336754 missense probably benign
IGL00965:Il12rb2 APN 6 67360577 missense probably damaging 0.98
IGL01161:Il12rb2 APN 6 67361865 splice site probably benign
IGL01980:Il12rb2 APN 6 67360535 missense probably benign
IGL02246:Il12rb2 APN 6 67308956 critical splice donor site probably null
IGL02807:Il12rb2 APN 6 67351316 missense probably damaging 1.00
R0003:Il12rb2 UTSW 6 67316286 missense probably damaging 1.00
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0462:Il12rb2 UTSW 6 67303610 missense possibly damaging 0.95
R0709:Il12rb2 UTSW 6 67298904 splice site probably benign
R0828:Il12rb2 UTSW 6 67356707 missense probably benign
R1051:Il12rb2 UTSW 6 67356735 missense probably benign
R1191:Il12rb2 UTSW 6 67298216 missense possibly damaging 0.90
R1446:Il12rb2 UTSW 6 67309143 missense probably benign
R1559:Il12rb2 UTSW 6 67356592 missense probably benign 0.12
R1677:Il12rb2 UTSW 6 67303501 missense probably damaging 1.00
R1689:Il12rb2 UTSW 6 67336760 missense probably benign 0.01
R1907:Il12rb2 UTSW 6 67295286 nonsense probably null
R1952:Il12rb2 UTSW 6 67292316 missense probably damaging 0.99
R2048:Il12rb2 UTSW 6 67360545 missense probably benign 0.05
R2074:Il12rb2 UTSW 6 67360552 missense probably damaging 1.00
R2351:Il12rb2 UTSW 6 67361944 nonsense probably null
R2358:Il12rb2 UTSW 6 67298195 missense probably damaging 0.96
R2680:Il12rb2 UTSW 6 67354805 missense possibly damaging 0.94
R2920:Il12rb2 UTSW 6 67360568 missense probably damaging 0.96
R3107:Il12rb2 UTSW 6 67360798 missense probably damaging 1.00
R4420:Il12rb2 UTSW 6 67316410 splice site probably null
R4838:Il12rb2 UTSW 6 67309137 missense probably damaging 1.00
R5391:Il12rb2 UTSW 6 67292420 missense probably benign 0.24
R5532:Il12rb2 UTSW 6 67292262 missense probably damaging 1.00
R5696:Il12rb2 UTSW 6 67295278 missense possibly damaging 0.94
R5704:Il12rb2 UTSW 6 67292213 missense possibly damaging 0.53
R5891:Il12rb2 UTSW 6 67360690 missense probably damaging 0.97
R6482:Il12rb2 UTSW 6 67356686 missense probably damaging 1.00
R6749:Il12rb2 UTSW 6 67361966 start gained probably benign
R6813:Il12rb2 UTSW 6 67292374 missense probably damaging 0.98
R6957:Il12rb2 UTSW 6 67292652 missense possibly damaging 0.60
R7312:Il12rb2 UTSW 6 67356633 missense probably benign 0.29
R7361:Il12rb2 UTSW 6 67303466 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ACACCTGTGCCACAGAACTTGTATG -3'
(R):5'- AGTGGTGATGATGCTTCAGTTTCCC -3'

Sequencing Primer
(F):5'- cctttacctgctaggcatcttc -3'
(R):5'- GATGCTTCAGTTTCCCAGTTTTCAG -3'
Posted On2013-04-11