Incidental Mutation 'R0079:Taf1d'
ID19615
Institutional Source Beutler Lab
Gene Symbol Taf1d
Ensembl Gene ENSMUSG00000031939
Gene NameTATA-box binding protein associated factor, RNA polymerase I, D
SynonymsTAF(I)41, TAFI41, 4930553M18Rik, Josd3
MMRRC Submission 038366-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R0079 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15306214-15316991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15309944 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 182 (A182V)
Ref Sequence ENSEMBL: ENSMUSP00000149377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034415] [ENSMUST00000164079] [ENSMUST00000178977] [ENSMUST00000180339] [ENSMUST00000213763] [ENSMUST00000214054] [ENSMUST00000215124] [ENSMUST00000216109] [ENSMUST00000216825] [ENSMUST00000216955]
Predicted Effect probably benign
Transcript: ENSMUST00000034415
AA Change: A182V

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034415
Gene: ENSMUSG00000031939
AA Change: A182V

DomainStartEndE-ValueType
Pfam:TAF1D 27 243 4.3e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158304
Predicted Effect probably benign
Transcript: ENSMUST00000164079
AA Change: A182V

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129141
Gene: ENSMUSG00000031939
AA Change: A182V

DomainStartEndE-ValueType
Pfam:TAF1D 27 243 5.4e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178977
SMART Domains Protein: ENSMUSP00000136335
Gene: ENSMUSG00000031938

DomainStartEndE-ValueType
DUF1907 19 303 3.83e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180339
SMART Domains Protein: ENSMUSP00000136717
Gene: ENSMUSG00000031938

DomainStartEndE-ValueType
DUF1907 19 303 3.83e-200 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213317
Predicted Effect probably benign
Transcript: ENSMUST00000213763
AA Change: A182V

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213923
Predicted Effect probably benign
Transcript: ENSMUST00000214054
AA Change: A182V

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214221
Predicted Effect probably benign
Transcript: ENSMUST00000214316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214899
Predicted Effect probably benign
Transcript: ENSMUST00000215124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215741
Predicted Effect unknown
Transcript: ENSMUST00000215749
AA Change: A15V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216073
Predicted Effect probably benign
Transcript: ENSMUST00000216109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216768
Predicted Effect probably benign
Transcript: ENSMUST00000216825
AA Change: A182V

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000216955
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency 78% (155/199)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAF1D is a member of the SL1 complex, which includes TBP (MIM 600075) and TAF1A (MIM 604903), TAF1B (MIM 604904), and TAF1C (MIM 604905), and plays a role in RNA polymerase I transcription (Wang et al., 2004 [PubMed 15520167]; Gorski et al., 2007 [PubMed 17318177]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,007,182 T105S possibly damaging Het
Abca13 G A 11: 9,293,493 M1785I probably benign Het
Adamts3 G C 5: 89,693,053 P804A probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ank2 G T 3: 126,934,615 D776E probably benign Het
Cep152 T A 2: 125,618,453 K193M possibly damaging Het
Cep55 C T 19: 38,060,321 L142F probably benign Het
Chd5 A G 4: 152,385,749 Y1884C probably damaging Het
Clasp1 T C 1: 118,543,304 L890P probably damaging Het
Cul9 C A 17: 46,537,663 E716* probably null Het
Cytip T A 2: 58,159,994 D21V probably benign Het
Denr T G 5: 123,924,845 F137C probably damaging Het
Dhrs3 A T 4: 144,920,048 S197C probably damaging Het
Egr4 A T 6: 85,512,769 M103K probably damaging Het
Eif4enif1 C T 11: 3,242,676 Q835* probably null Het
Gckr A G 5: 31,306,539 I268V probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Hpd T C 5: 123,181,481 Y8C probably damaging Het
Il12rb2 A T 6: 67,361,905 F16I probably benign Het
Ildr2 A T 1: 166,307,720 Y347F probably damaging Het
Kcnv1 T C 15: 45,113,333 D186G probably damaging Het
Khdrbs2 A G 1: 32,519,915 probably null Het
L1cam G T X: 73,869,758 P16H probably damaging Het
Lyn A G 4: 3,746,768 H161R probably damaging Het
Mctp2 T A 7: 72,214,116 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mitf A C 6: 97,996,440 M220L probably benign Het
Mrpl21 T C 19: 3,284,807 Y50H possibly damaging Het
Myh1 T A 11: 67,213,411 L968Q probably damaging Het
Myo3b A G 2: 70,095,158 K18E possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp2 T A 7: 5,327,730 T556S possibly damaging Het
Nsmf T C 2: 25,059,084 probably benign Het
Nsun7 C T 5: 66,295,513 P558S probably benign Het
Olfr1168 A T 2: 88,185,354 Y159F possibly damaging Het
Olfr1564 G A 17: 33,216,105 R80C probably benign Het
Olfr394 T G 11: 73,887,737 I212L probably benign Het
Olfr679 T C 7: 105,085,928 S71P probably damaging Het
Papd5 T A 8: 88,200,003 Y14N possibly damaging Het
Phf19 T C 2: 34,895,954 N501S probably benign Het
Ranbp17 A C 11: 33,500,682 I85S probably damaging Het
Robo1 A G 16: 72,933,342 probably benign Het
Sntg1 A G 1: 8,679,062 probably benign Het
Snx15 A G 19: 6,123,913 L58P probably damaging Het
Spink5 G T 18: 43,977,764 C134F probably damaging Het
Strip2 T C 6: 29,920,533 probably null Het
Tenm3 A G 8: 48,343,345 V475A possibly damaging Het
Tgds A T 14: 118,116,235 H223Q possibly damaging Het
Thoc2 G T X: 41,864,108 S230Y probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Trak2 A T 1: 58,926,724 L97Q probably damaging Het
Trnau1ap A G 4: 132,314,345 Y145H probably damaging Het
Vars2 A T 17: 35,659,156 D780E probably damaging Het
Vmn1r170 T A 7: 23,606,310 S46T possibly damaging Het
Vmn1r20 A T 6: 57,431,792 R34S possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdr64 T C 1: 175,795,102 M805T probably benign Het
Xdh G A 17: 73,891,218 R1225C probably damaging Het
Zfp341 T A 2: 154,624,994 Y94* probably null Het
Zfp641 T C 15: 98,289,089 N218D probably benign Het
Zscan22 T C 7: 12,904,087 probably null Het
Other mutations in Taf1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Taf1d APN 9 15311603 missense probably damaging 0.99
IGL01861:Taf1d APN 9 15308739 unclassified probably null
IGL02448:Taf1d APN 9 15310394 nonsense probably null
IGL03106:Taf1d APN 9 15309941 missense possibly damaging 0.83
R0026:Taf1d UTSW 9 15308648 missense probably damaging 1.00
R0026:Taf1d UTSW 9 15308648 missense probably damaging 1.00
R4298:Taf1d UTSW 9 15308643 missense probably damaging 1.00
R4379:Taf1d UTSW 9 15311981 intron probably benign
R4381:Taf1d UTSW 9 15311981 intron probably benign
R4927:Taf1d UTSW 9 15309954 missense probably damaging 0.99
R5541:Taf1d UTSW 9 15308850 missense probably damaging 0.99
R6072:Taf1d UTSW 9 15311560 missense probably benign 0.00
R6736:Taf1d UTSW 9 15307823 critical splice donor site probably null
R7527:Taf1d UTSW 9 15308837 missense possibly damaging 0.94
X0057:Taf1d UTSW 9 15308520 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGTCCTTTTGATGAACGGCAAGC -3'
(R):5'- TCCTCCCAAAGCTGATGTCCTGTG -3'

Sequencing Primer
(F):5'- CGGCAAGCCATTGTTTATTTAGC -3'
(R):5'- gcacttgagaggcaggtaaatg -3'
Posted On2013-04-11