Incidental Mutation 'R0079:Zfp641'
ID19623
Institutional Source Beutler Lab
Gene Symbol Zfp641
Ensembl Gene ENSMUSG00000022987
Gene Namezinc finger protein 641
Synonyms9930016F01Rik
MMRRC Submission 038366-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0079 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98285585-98296161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98289089 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 218 (N218D)
Ref Sequence ENSEMBL: ENSMUSP00000133212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023722] [ENSMUST00000169721]
Predicted Effect probably benign
Transcript: ENSMUST00000023722
AA Change: N204D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023722
Gene: ENSMUSG00000022987
AA Change: N204D

DomainStartEndE-ValueType
KRAB 91 142 2.16e-10 SMART
ZnF_C2H2 236 258 1.58e-3 SMART
ZnF_C2H2 264 286 1.67e-2 SMART
ZnF_C2H2 292 314 1.33e-1 SMART
ZnF_C2H2 342 364 8.94e-3 SMART
ZnF_C2H2 370 392 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169721
AA Change: N218D

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133212
Gene: ENSMUSG00000022987
AA Change: N218D

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
KRAB 95 156 2.56e-21 SMART
ZnF_C2H2 250 272 1.58e-3 SMART
ZnF_C2H2 278 300 1.67e-2 SMART
ZnF_C2H2 306 328 1.33e-1 SMART
ZnF_C2H2 356 378 8.94e-3 SMART
ZnF_C2H2 384 406 3.83e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency 78% (155/199)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,007,182 T105S possibly damaging Het
Abca13 G A 11: 9,293,493 M1785I probably benign Het
Adamts3 G C 5: 89,693,053 P804A probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ank2 G T 3: 126,934,615 D776E probably benign Het
Cep152 T A 2: 125,618,453 K193M possibly damaging Het
Cep55 C T 19: 38,060,321 L142F probably benign Het
Chd5 A G 4: 152,385,749 Y1884C probably damaging Het
Clasp1 T C 1: 118,543,304 L890P probably damaging Het
Cul9 C A 17: 46,537,663 E716* probably null Het
Cytip T A 2: 58,159,994 D21V probably benign Het
Denr T G 5: 123,924,845 F137C probably damaging Het
Dhrs3 A T 4: 144,920,048 S197C probably damaging Het
Egr4 A T 6: 85,512,769 M103K probably damaging Het
Eif4enif1 C T 11: 3,242,676 Q835* probably null Het
Gckr A G 5: 31,306,539 I268V probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Hpd T C 5: 123,181,481 Y8C probably damaging Het
Il12rb2 A T 6: 67,361,905 F16I probably benign Het
Ildr2 A T 1: 166,307,720 Y347F probably damaging Het
Kcnv1 T C 15: 45,113,333 D186G probably damaging Het
Khdrbs2 A G 1: 32,519,915 probably null Het
L1cam G T X: 73,869,758 P16H probably damaging Het
Lyn A G 4: 3,746,768 H161R probably damaging Het
Mctp2 T A 7: 72,214,116 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mitf A C 6: 97,996,440 M220L probably benign Het
Mrpl21 T C 19: 3,284,807 Y50H possibly damaging Het
Myh1 T A 11: 67,213,411 L968Q probably damaging Het
Myo3b A G 2: 70,095,158 K18E possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp2 T A 7: 5,327,730 T556S possibly damaging Het
Nsmf T C 2: 25,059,084 probably benign Het
Nsun7 C T 5: 66,295,513 P558S probably benign Het
Olfr1168 A T 2: 88,185,354 Y159F possibly damaging Het
Olfr1564 G A 17: 33,216,105 R80C probably benign Het
Olfr394 T G 11: 73,887,737 I212L probably benign Het
Olfr679 T C 7: 105,085,928 S71P probably damaging Het
Papd5 T A 8: 88,200,003 Y14N possibly damaging Het
Phf19 T C 2: 34,895,954 N501S probably benign Het
Ranbp17 A C 11: 33,500,682 I85S probably damaging Het
Robo1 A G 16: 72,933,342 probably benign Het
Sntg1 A G 1: 8,679,062 probably benign Het
Snx15 A G 19: 6,123,913 L58P probably damaging Het
Spink5 G T 18: 43,977,764 C134F probably damaging Het
Strip2 T C 6: 29,920,533 probably null Het
Taf1d C T 9: 15,309,944 A182V probably benign Het
Tenm3 A G 8: 48,343,345 V475A possibly damaging Het
Tgds A T 14: 118,116,235 H223Q possibly damaging Het
Thoc2 G T X: 41,864,108 S230Y probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Trak2 A T 1: 58,926,724 L97Q probably damaging Het
Trnau1ap A G 4: 132,314,345 Y145H probably damaging Het
Vars2 A T 17: 35,659,156 D780E probably damaging Het
Vmn1r170 T A 7: 23,606,310 S46T possibly damaging Het
Vmn1r20 A T 6: 57,431,792 R34S possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdr64 T C 1: 175,795,102 M805T probably benign Het
Xdh G A 17: 73,891,218 R1225C probably damaging Het
Zfp341 T A 2: 154,624,994 Y94* probably null Het
Zscan22 T C 7: 12,904,087 probably null Het
Other mutations in Zfp641
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Zfp641 APN 15 98291185 missense possibly damaging 0.85
IGL03092:Zfp641 APN 15 98290516 missense probably damaging 1.00
IGL03191:Zfp641 APN 15 98288687 missense probably damaging 0.98
R0243:Zfp641 UTSW 15 98289127 missense possibly damaging 0.82
R0487:Zfp641 UTSW 15 98289179 missense probably benign
R2092:Zfp641 UTSW 15 98293712 missense probably benign
R3415:Zfp641 UTSW 15 98290540 missense probably benign 0.28
R4834:Zfp641 UTSW 15 98293704 missense probably damaging 1.00
R4851:Zfp641 UTSW 15 98288717 missense probably damaging 0.99
R5776:Zfp641 UTSW 15 98289010 missense probably damaging 1.00
R6057:Zfp641 UTSW 15 98292935 missense probably benign 0.00
R6896:Zfp641 UTSW 15 98293803 start codon destroyed probably benign 0.06
R6958:Zfp641 UTSW 15 98292951 missense possibly damaging 0.46
R6969:Zfp641 UTSW 15 98290567 missense possibly damaging 0.46
Z1177:Zfp641 UTSW 15 98288535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACACATGGCACTTTGGCAC -3'
(R):5'- TCTGGGCTAACATTTGTCATCAGGC -3'

Sequencing Primer
(F):5'- AGCTGCATCGGAAACTCTTG -3'
(R):5'- ACATTTGTCATCAGGCAATGTTCC -3'
Posted On2013-04-11