Mutagenetix > Incidental Mutation

Incidental Mutation 'R0079:Spink5'

19628

Institutional Source

Beutler Lab

Gene Symbol

Spink5

Ensembl Gene

ENSMUSG00000055561

Gene Name

serine peptidase inhibitor, Kazal type 5

Synonyms

2310065D10Rik, LEKT1

MMRRC Submission

038366-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43963235-44022501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 43977764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 134 (C134F)

Ref Sequence

ENSEMBL: ENSMUSP00000066214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069245]

AlphaFold

Q148R4

Predicted Effect

probably damaging
Transcript: ENSMUST00000069245
AA Change: C134F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: C134F

Domain	Start	End	E-Value	Type
PDB:1UUC\|A	26	77	3e-6	PDB
KAZAL	97	152	1.67e-15	SMART
KAZAL	161	216	2.07e-3	SMART
KAZAL	226	281	3.37e-11	SMART
KAZAL	298	353	2.92e-6	SMART
KAZAL	367	424	6.73e-3	SMART
KAZAL	426	480	6.07e-4	SMART
KAZAL	496	558	2.43e-1	SMART
KAZAL	559	614	2.72e-15	SMART
KAZAL	633	687	1.95e-7	SMART
KAZAL	700	755	1.01e-9	SMART
KAZAL	769	824	7.29e-7	SMART
KAZAL	865	931	1.32e-4	SMART
KAZAL	942	996	2.74e-11	SMART

Meta Mutation Damage Score

0.1656

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 95.4%
20x: 90.7%

Validation Efficiency

78% (155/199)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004P03Rik	T	A	12: 17,007,182	T105S	possibly damaging	Het
Abca13	G	A	11: 9,293,493	M1785I	probably benign	Het
Adamts3	G	C	5: 89,693,053	P804A	probably benign	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Ank2	G	T	3: 126,934,615	D776E	probably benign	Het
Cep152	T	A	2: 125,618,453	K193M	possibly damaging	Het
Cep55	C	T	19: 38,060,321	L142F	probably benign	Het
Chd5	A	G	4: 152,385,749	Y1884C	probably damaging	Het
Clasp1	T	C	1: 118,543,304	L890P	probably damaging	Het
Cul9	C	A	17: 46,537,663	E716*	probably null	Het
Cytip	T	A	2: 58,159,994	D21V	probably benign	Het
Denr	T	G	5: 123,924,845	F137C	probably damaging	Het
Dhrs3	A	T	4: 144,920,048	S197C	probably damaging	Het
Egr4	A	T	6: 85,512,769	M103K	probably damaging	Het
Eif4enif1	C	T	11: 3,242,676	Q835*	probably null	Het
Gckr	A	G	5: 31,306,539	I268V	probably benign	Het
Glt6d1	C	A	2: 25,794,727		probably null	Het
Hpd	T	C	5: 123,181,481	Y8C	probably damaging	Het
Il12rb2	A	T	6: 67,361,905	F16I	probably benign	Het
Ildr2	A	T	1: 166,307,720	Y347F	probably damaging	Het
Kcnv1	T	C	15: 45,113,333	D186G	probably damaging	Het
Khdrbs2	A	G	1: 32,519,915		probably null	Het
L1cam	G	T	X: 73,869,758	P16H	probably damaging	Het
Lyn	A	G	4: 3,746,768	H161R	probably damaging	Het
Mctp2	T	A	7: 72,214,116		probably benign	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mitf	A	C	6: 97,996,440	M220L	probably benign	Het
Mrpl21	T	C	19: 3,284,807	Y50H	possibly damaging	Het
Myh1	T	A	11: 67,213,411	L968Q	probably damaging	Het
Myo3b	A	G	2: 70,095,158	K18E	possibly damaging	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Nlrp2	T	A	7: 5,327,730	T556S	possibly damaging	Het
Nsmf	T	C	2: 25,059,084		probably benign	Het
Nsun7	C	T	5: 66,295,513	P558S	probably benign	Het
Olfr1168	A	T	2: 88,185,354	Y159F	possibly damaging	Het
Olfr1564	G	A	17: 33,216,105	R80C	probably benign	Het
Olfr394	T	G	11: 73,887,737	I212L	probably benign	Het
Olfr679	T	C	7: 105,085,928	S71P	probably damaging	Het
Papd5	T	A	8: 88,200,003	Y14N	possibly damaging	Het
Phf19	T	C	2: 34,895,954	N501S	probably benign	Het
Ranbp17	A	C	11: 33,500,682	I85S	probably damaging	Het
Robo1	A	G	16: 72,933,342		probably benign	Het
Sntg1	A	G	1: 8,679,062		probably benign	Het
Snx15	A	G	19: 6,123,913	L58P	probably damaging	Het
Strip2	T	C	6: 29,920,533		probably null	Het
Taf1d	C	T	9: 15,309,944	A182V	probably benign	Het
Tenm3	A	G	8: 48,343,345	V475A	possibly damaging	Het
Tgds	A	T	14: 118,116,235	H223Q	possibly damaging	Het
Thoc2	G	T	X: 41,864,108	S230Y	probably benign	Het
Tm9sf4	T	A	2: 153,191,145	V290E	probably damaging	Het
Trak2	A	T	1: 58,926,724	L97Q	probably damaging	Het
Trnau1ap	A	G	4: 132,314,345	Y145H	probably damaging	Het
Vars2	A	T	17: 35,659,156	D780E	probably damaging	Het
Vmn1r170	T	A	7: 23,606,310	S46T	possibly damaging	Het
Vmn1r20	A	T	6: 57,431,792	R34S	possibly damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Wdr64	T	C	1: 175,795,102	M805T	probably benign	Het
Xdh	G	A	17: 73,891,218	R1225C	probably damaging	Het
Zfp341	T	A	2: 154,624,994	Y94*	probably null	Het
Zfp641	T	C	15: 98,289,089	N218D	probably benign	Het
Zscan22	T	C	7: 12,904,087		probably null	Het

Other mutations in Spink5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Spink5	APN	18	43987871	splice site	probably benign
IGL00332:Spink5	APN	18	43967044	missense	probably benign	0.00
IGL00501:Spink5	APN	18	43977739	missense	probably damaging	0.98
IGL00772:Spink5	APN	18	44006420	missense	probably benign	0.02
IGL00920:Spink5	APN	18	44003209	missense	probably damaging	1.00
IGL00980:Spink5	APN	18	44007710	missense	probably damaging	1.00
IGL01016:Spink5	APN	18	44007644	missense	probably damaging	1.00
IGL01155:Spink5	APN	18	43981147	missense	probably benign	0.01
IGL01374:Spink5	APN	18	43989404	missense	possibly damaging	0.74
IGL01629:Spink5	APN	18	43996610	splice site	probably benign
IGL01907:Spink5	APN	18	43996676	missense	probably damaging	1.00
IGL01931:Spink5	APN	18	44015638	missense	probably benign	0.02
IGL02237:Spink5	APN	18	44012867	missense	probably benign	0.03
IGL02306:Spink5	APN	18	43964444	missense	probably damaging	0.98
IGL02402:Spink5	APN	18	43967104	missense	probably damaging	1.00
IGL02425:Spink5	APN	18	43990744	critical splice donor site	probably null
IGL02552:Spink5	APN	18	43992168	missense	possibly damaging	0.80
IGL02554:Spink5	APN	18	44015594	missense	probably benign	0.01
IGL03066:Spink5	APN	18	44016390	missense	probably damaging	1.00
IGL03288:Spink5	APN	18	44014760	missense	possibly damaging	0.59
crusty2	UTSW	18	43999935	splice site	probably benign
R0184:Spink5	UTSW	18	44003198	missense	probably benign	0.00
R0452:Spink5	UTSW	18	43963318	missense	possibly damaging	0.74
R0569:Spink5	UTSW	18	43989419	missense	probably damaging	1.00
R0639:Spink5	UTSW	18	44012975	splice site	probably null
R0648:Spink5	UTSW	18	43999797	splice site	probably benign
R0705:Spink5	UTSW	18	43992274	missense	probably benign	0.01
R1170:Spink5	UTSW	18	43983563	missense	probably benign	0.07
R1290:Spink5	UTSW	18	44007711	missense	probably damaging	0.99
R1345:Spink5	UTSW	18	43990682	missense	possibly damaging	0.88
R1458:Spink5	UTSW	18	44007719	missense	probably benign	0.01
R1530:Spink5	UTSW	18	44015671	missense	probably damaging	0.96
R1570:Spink5	UTSW	18	43967107	missense	probably benign	0.00
R1820:Spink5	UTSW	18	43989419	missense	possibly damaging	0.94
R1843:Spink5	UTSW	18	43999891	missense	probably benign	0.03
R1968:Spink5	UTSW	18	43990708	missense	probably benign	0.06
R2050:Spink5	UTSW	18	44007758	critical splice donor site	probably null
R2252:Spink5	UTSW	18	44020824	nonsense	probably null
R2278:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2279:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2696:Spink5	UTSW	18	43982292	missense	probably damaging	1.00
R2992:Spink5	UTSW	18	43996629	missense	probably damaging	1.00
R3422:Spink5	UTSW	18	44010244	missense	probably benign	0.01
R3934:Spink5	UTSW	18	44016427	missense	probably damaging	1.00
R4179:Spink5	UTSW	18	43987867	missense	probably benign
R4854:Spink5	UTSW	18	44020841	makesense	probably null
R5011:Spink5	UTSW	18	44006412	missense	probably damaging	0.97
R5133:Spink5	UTSW	18	43986423	missense	probably damaging	1.00
R5163:Spink5	UTSW	18	43999857	missense	possibly damaging	0.95
R5185:Spink5	UTSW	18	44015644	missense	probably damaging	0.97
R5187:Spink5	UTSW	18	43989451	missense	probably damaging	1.00
R5292:Spink5	UTSW	18	44006454	missense	probably benign
R5332:Spink5	UTSW	18	43992917	missense	possibly damaging	0.89
R5600:Spink5	UTSW	18	44018711	missense	probably damaging	0.96
R6267:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6296:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6373:Spink5	UTSW	18	43990672	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	43977725	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	44010042	splice site	probably null
R7332:Spink5	UTSW	18	43982250	missense	probably damaging	0.96
R7396:Spink5	UTSW	18	43977655	missense	possibly damaging	0.95
R7643:Spink5	UTSW	18	44010252	missense	probably benign	0.37
R7726:Spink5	UTSW	18	43963352	missense	probably damaging	1.00
R7828:Spink5	UTSW	18	44010229	missense	probably benign	0.15
R7836:Spink5	UTSW	18	43999821	missense	probably benign	0.00
R7880:Spink5	UTSW	18	43986326	missense	probably benign	0.40
R8031:Spink5	UTSW	18	44010236	missense	probably benign	0.07
R8198:Spink5	UTSW	18	43992880	missense	probably benign	0.17
R8361:Spink5	UTSW	18	43989462	missense	probably damaging	1.00
R8375:Spink5	UTSW	18	43990719	missense	probably benign	0.01
R8684:Spink5	UTSW	18	44010238	missense	probably benign	0.02
R8749:Spink5	UTSW	18	43989358	nonsense	probably null
R8918:Spink5	UTSW	18	43967020	missense	probably damaging	0.98
R9064:Spink5	UTSW	18	43967126	missense	probably damaging	1.00
R9161:Spink5	UTSW	18	44014919	missense	probably damaging	1.00
R9221:Spink5	UTSW	18	43986300	missense	probably damaging	1.00
R9292:Spink5	UTSW	18	44015008	missense	possibly damaging	0.91
R9545:Spink5	UTSW	18	44003195	missense	possibly damaging	0.88
Z1177:Spink5	UTSW	18	43996635	missense	probably damaging	0.97
Z1177:Spink5	UTSW	18	43996697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCTTGGCTTATCTCACCCAAAC -3'
(R):5'- AGAGGCTGTGGTAACTGTCCAAAAC -3'

Sequencing Primer
(F):5'- AGATTGTGGGCTTGAAGTACTAACC -3'
(R):5'- GCTGTGGTAACTGTCCAAAACTATTC -3'

Posted On

2013-04-11