Incidental Mutation 'R1785:Ptpn22'
ID 196356
Institutional Source Beutler Lab
Gene Symbol Ptpn22
Ensembl Gene ENSMUSG00000027843
Gene Name protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Synonyms Ptpn8, 70zpep
MMRRC Submission 039816-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.879) question?
Stock # R1785 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 103767111-103819563 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103781368 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 90 (I90V)
Ref Sequence ENSEMBL: ENSMUSP00000029433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029433] [ENSMUST00000146071]
AlphaFold P29352
PDB Structure Solution structure of the SH3 domain from C-terminal Src Kinase complexed with a peptide from the tyrosine phosphatase PEP [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000029433
AA Change: I90V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029433
Gene: ENSMUSG00000027843
AA Change: I90V

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 2e-65 BLAST
PDB:1JEG|B 605 629 2e-8 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000146071
AA Change: I90V

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122307
Gene: ENSMUSG00000027843
AA Change: I90V

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 9e-66 BLAST
internal_repeat_1 567 629 1.92e-7 PROSPERO
internal_repeat_1 651 705 1.92e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198530
Meta Mutation Damage Score 0.5572 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice display antigen dependent increases in T cell proliferation and cytokine production, enlarged spleens and lymph nodes, increased spontaneous germinal center formation, increased B cell numbers, and increased serum IgG and IgE levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 243 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Adgrf4 C T 17: 42,977,789 (GRCm39) R518Q possibly damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Arhgap23 A G 11: 97,342,387 (GRCm39) D223G possibly damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Aspm A G 1: 139,401,312 (GRCm39) I1111V probably benign Het
C4bp C G 1: 130,570,725 (GRCm39) V284L probably benign Het
Cacna1s T C 1: 136,046,454 (GRCm39) F1761S probably benign Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camsap2 C T 1: 136,209,053 (GRCm39) R802Q probably benign Het
Capn11 A G 17: 45,949,623 (GRCm39) S448P probably benign Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Cbx5 G A 15: 103,121,551 (GRCm39) R29C probably null Het
Ccdc93 C T 1: 121,383,855 (GRCm39) P192L probably benign Het
Ccdc93 T C 1: 121,389,668 (GRCm39) V237A probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cd55 C A 1: 130,387,370 (GRCm39) A143S probably benign Het
Cdh19 C A 1: 110,821,114 (GRCm39) E541D probably damaging Het
Cdh20 C G 1: 109,993,465 (GRCm39) L307V possibly damaging Het
Cfh T C 1: 140,064,526 (GRCm39) K374R probably benign Het
Cfh C T 1: 140,075,435 (GRCm39) V268I possibly damaging Het
Cfhr2 A G 1: 139,741,180 (GRCm39) M265T probably benign Het
Cfhr2 A C 1: 139,741,197 (GRCm39) N259K probably benign Het
Chi3l1 C T 1: 134,116,267 (GRCm39) A250V probably damaging Het
Cntnap5a C T 1: 116,382,873 (GRCm39) T1047I probably benign Het
Cntnap5a C A 1: 116,382,734 (GRCm39) L1001I probably benign Het
Cntnap5a T C 1: 116,382,831 (GRCm39) L1033S probably benign Het
Cntnap5c A G 17: 58,469,286 (GRCm39) I623V probably benign Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Crb1 G A 1: 139,168,876 (GRCm39) P881S probably damaging Het
Crb1 C T 1: 139,170,733 (GRCm39) G825R probably damaging Het
Crb1 C T 1: 139,171,155 (GRCm39) R684H probably benign Het
Crb1 T C 1: 139,162,517 (GRCm39) M1214V probably benign Het
Crb1 A T 1: 139,165,360 (GRCm39) H921Q probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Cxcr4 C T 1: 128,517,014 (GRCm39) V216I probably benign Het
Cyb5r1 C T 1: 134,335,405 (GRCm39) R147W probably damaging Het
Daxx T C 17: 34,130,816 (GRCm39) I277T probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Ddx59 T C 1: 136,344,791 (GRCm39) V154A probably benign Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dnah8 T C 17: 30,941,911 (GRCm39) V1719A probably damaging Het
Dsel T C 1: 111,787,187 (GRCm39) N1116S probably benign Het
Dsel G C 1: 111,787,724 (GRCm39) T937S probably benign Het
Dstyk C T 1: 132,384,722 (GRCm39) L739F probably damaging Het
En1 A G 1: 120,531,350 (GRCm39) S197G unknown Het
Enah A T 1: 181,783,994 (GRCm39) M105K unknown Het
Epm2a A G 10: 11,219,426 (GRCm39) E71G probably benign Het
Etnk2 C A 1: 133,293,325 (GRCm39) D89E probably benign Het
Etnk2 G T 1: 133,293,503 (GRCm39) G149W probably damaging Het
Etnk2 C T 1: 133,293,554 (GRCm39) R166* probably null Het
Etnk2 G A 1: 133,293,555 (GRCm39) R166Q probably benign Het
Etnk2 T A 1: 133,304,653 (GRCm39) V292E probably benign Het
Etnk2 A G 1: 133,291,661 (GRCm39) S54G probably benign Het
Eya1 A G 1: 14,241,198 (GRCm39) V573A probably benign Het
Faim2 A G 15: 99,410,423 (GRCm39) L235P probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Fam72a C T 1: 131,466,633 (GRCm39) T139M probably benign Het
Fam72a T C 1: 131,458,406 (GRCm39) I56T probably benign Het
Fbxw10 T A 11: 62,750,683 (GRCm39) I422N probably damaging Het
Fcamr A C 1: 130,732,364 (GRCm39) N117T probably benign Het
Fcamr A G 1: 130,739,317 (GRCm39) I206V probably benign Het
Fcamr G A 1: 130,740,366 (GRCm39) G262S probably benign Het
Fcamr A G 1: 130,740,429 (GRCm39) I283V probably benign Het
Fcamr T C 1: 130,740,475 (GRCm39) V298A probably benign Het
Fcamr A G 1: 130,740,546 (GRCm39) M322V probably benign Het
Fcamr C T 1: 130,740,553 (GRCm39) P324L probably benign Het
Fcamr A G 1: 130,742,334 (GRCm39) N574D probably benign Het
Fcamr A G 1: 130,732,306 (GRCm39) R98G probably benign Het
Fcmr T C 1: 130,806,006 (GRCm39) S321P probably benign Het
Fcmr A G 1: 130,803,711 (GRCm39) T172A probably benign Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gabarap C T 11: 69,882,515 (GRCm39) probably benign Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gli2 G T 1: 118,929,774 (GRCm39) H44Q probably benign Het
Gli2 C T 1: 118,795,817 (GRCm39) A113T possibly damaging Het
Glrx2 C T 1: 143,615,478 (GRCm39) A27V possibly damaging Het
Gm10563 C T 4: 155,720,337 (GRCm39) probably benign Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,255,059 (GRCm39) probably benign Het
Gm8374 T C 14: 18,537,078 (GRCm39) T49A probably damaging Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gpr25 G A 1: 136,188,448 (GRCm39) P55L probably benign Het
Grm7 G C 6: 111,335,256 (GRCm39) D556H probably damaging Het
H2-K2 C A 17: 34,216,322 (GRCm39) E275* probably null Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Igfn1 T C 1: 135,926,421 (GRCm39) I10V unknown Het
Igfn1 T C 1: 135,898,149 (GRCm39) S806G probably benign Het
Igfn1 G A 1: 135,895,937 (GRCm39) A1543V probably benign Het
Igfn1 G A 1: 135,887,666 (GRCm39) P2466L probably damaging Het
Igfn1 C T 1: 135,899,865 (GRCm39) R482Q probably benign Het
Igfn1 C T 1: 135,907,653 (GRCm39) A231T probably benign Het
Igfn1 G A 1: 135,910,213 (GRCm39) R124W probably benign Het
Igfn1 T C 1: 135,926,363 (GRCm39) E29G probably benign Het
Ikbke C A 1: 131,193,674 (GRCm39) A459S probably benign Het
Ikbke T C 1: 131,197,560 (GRCm39) S447G probably benign Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Ipo9 TCC TCCGCC 1: 135,314,019 (GRCm39) probably benign Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Kcnt2 G A 1: 140,282,285 (GRCm39) S90N probably benign Het
Kif14 T C 1: 136,453,521 (GRCm39) V1433A probably benign Het
Kif14 T C 1: 136,443,699 (GRCm39) F1291L probably benign Het
Kif14 C T 1: 136,431,169 (GRCm39) L1189F probably benign Het
Kif14 A G 1: 136,418,070 (GRCm39) S868G probably benign Het
Kif14 G A 1: 136,406,103 (GRCm39) A556T probably benign Het
Kif14 A G 1: 136,396,713 (GRCm39) K340E probably damaging Het
Kif14 A G 1: 136,396,017 (GRCm39) N108D probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Krtap16-1 A T 11: 99,876,602 (GRCm39) C267* probably null Het
Lad1 C T 1: 135,755,761 (GRCm39) R346C probably damaging Het
Lad1 C T 1: 135,755,119 (GRCm39) P132S possibly damaging Het
Lax1 T C 1: 133,608,307 (GRCm39) N145D probably benign Het
Lax1 G A 1: 133,611,372 (GRCm39) P67S probably damaging Het
Lax1 T C 1: 133,607,716 (GRCm39) R342G probably benign Het
Lgr6 A T 1: 134,915,747 (GRCm39) S334T probably benign Het
Lgr6 G T 1: 134,918,373 (GRCm39) H263N probably benign Het
Lgr6 C T 1: 134,931,214 (GRCm39) S3N probably benign Het
Lgr6 C T 1: 134,914,826 (GRCm39) V641I probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmod1 C T 1: 135,291,811 (GRCm39) T222I probably benign Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mki67 T A 7: 135,305,970 (GRCm39) probably null Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Mpo A G 11: 87,688,187 (GRCm39) D282G possibly damaging Het
Mroh3 G C 1: 136,119,882 (GRCm39) Q440E possibly damaging Het
Mybph C T 1: 134,125,218 (GRCm39) R249C probably benign Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Nav1 A T 1: 135,512,465 (GRCm39) D198E possibly damaging Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nr5a2 C A 1: 136,879,863 (GRCm39) R35L probably benign Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Optc C G 1: 133,832,908 (GRCm39) S64T probably benign Het
Or11m3 A T 15: 98,395,716 (GRCm39) D121V probably damaging Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or5k3 A G 16: 58,969,660 (GRCm39) Y149C probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pbx1 T G 1: 168,258,947 (GRCm39) I43L probably benign Het
Phf2 T C 13: 48,971,043 (GRCm39) D543G unknown Het
Pigr C T 1: 130,772,259 (GRCm39) A159V possibly damaging Het
Pik3c2b C T 1: 132,994,365 (GRCm39) P110S probably benign Het
Pkd1 T C 17: 24,810,073 (GRCm39) V3558A probably benign Het
Pla2g6 T C 15: 79,190,545 (GRCm39) Y339C probably benign Het
Plcb1 T A 2: 135,167,587 (GRCm39) Y460* probably null Het
Plekha6 C G 1: 133,215,584 (GRCm39) T792S probably benign Het
Ppard T G 17: 28,517,455 (GRCm39) probably null Het
Ppfia4 G A 1: 134,227,059 (GRCm39) P1159S probably benign Het
Ppm1f A G 16: 16,728,834 (GRCm39) T79A probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn7 A G 1: 135,062,213 (GRCm39) Q53R probably benign Het
Ptprc T G 1: 138,027,414 (GRCm39) N478T probably benign Het
Ptprc T C 1: 138,039,992 (GRCm39) K212E possibly damaging Het
Ptprc A G 1: 138,035,575 (GRCm39) V400A probably benign Het
Ptprc C A 1: 138,035,562 (GRCm39) E402D probably benign Het
Ptprc A G 1: 138,035,561 (GRCm39) S405P probably benign Het
Pus7l T C 15: 94,438,518 (GRCm39) N109S probably benign Het
Rab29 A G 1: 131,799,848 (GRCm39) Q141R probably benign Het
Ren1 T A 1: 133,281,944 (GRCm39) W22R probably damaging Het
Ren1 C G 1: 133,278,516 (GRCm39) probably null Het
Ren1 C G 1: 133,287,745 (GRCm39) L360V probably benign Het
Ren1 A T 1: 133,287,721 (GRCm39) N352Y probably benign Het
Ren1 A T 1: 133,286,817 (GRCm39) E315D probably benign Het
Ren1 C T 1: 133,281,975 (GRCm39) T32I probably benign Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Ripk4 A C 16: 97,551,331 (GRCm39) V149G probably damaging Het
Rnpep C T 1: 135,190,834 (GRCm39) A571T possibly damaging Het
Rnpep G C 1: 135,211,715 (GRCm39) A11G probably benign Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ro60 C T 1: 143,635,752 (GRCm39) V465I probably benign Het
Rora G A 9: 69,284,119 (GRCm39) A396T probably benign Het
Scap C T 9: 110,203,123 (GRCm39) L266F probably damaging Het
Scn5a A T 9: 119,350,195 (GRCm39) I893N probably damaging Het
Sctr T C 1: 119,959,386 (GRCm39) F110L probably benign Het
Sctr G A 1: 119,990,987 (GRCm39) S440N possibly damaging Het
Sctr G T 1: 119,990,976 (GRCm39) E453D probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Serpinb10 C T 1: 107,466,203 (GRCm39) S63F probably damaging Het
Serpinb2 C A 1: 107,451,564 (GRCm39) A239E probably benign Het
Serpinb2 C T 1: 107,451,620 (GRCm39) H258Y probably benign Het
Serpinb2 C T 1: 107,451,624 (GRCm39) T259I probably benign Het
Serpinb2 A C 1: 107,452,273 (GRCm39) S284R probably benign Het
Serpinb2 G A 1: 107,443,365 (GRCm39) A55T probably damaging Het
Serpinb8 A C 1: 107,534,734 (GRCm39) L268F probably benign Het
Serpinb8 A G 1: 107,525,257 (GRCm39) S20G probably benign Het
Serpinb8 G A 1: 107,526,684 (GRCm39) A75T probably benign Het
Slc26a9 C T 1: 131,691,608 (GRCm39) A617V probably benign Het
Slc26a9 C A 1: 131,693,750 (GRCm39) R747S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slc9a9 A T 9: 94,901,246 (GRCm39) N393I possibly damaging Het
Stard13 T C 5: 150,968,633 (GRCm39) Y879C probably damaging Het
Steap3 G A 1: 120,162,108 (GRCm39) A350V probably benign Het
Steap3 T C 1: 120,155,480 (GRCm39) N493S probably benign Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tbx1 A C 16: 18,403,879 (GRCm39) F138V probably damaging Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Thsd7b T A 1: 129,595,674 (GRCm39) F498Y probably benign Het
Thsd7b C T 1: 129,556,628 (GRCm39) T328I probably damaging Het
Thsd7b A C 1: 130,044,368 (GRCm39) Q1116P probably benign Het
Thsd7b G C 1: 129,605,920 (GRCm39) A554P probably benign Het
Tnnt2 C T 1: 135,773,244 (GRCm39) probably benign Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Trim33 AGACTG A 3: 103,236,536 (GRCm39) probably null Het
Trim41 C A 11: 48,698,419 (GRCm39) G516W probably damaging Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Ttn A C 2: 76,716,270 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ube2t C T 1: 134,899,905 (GRCm39) A149V probably benign Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Vmn2r55 A T 7: 12,402,111 (GRCm39) D392E probably damaging Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps26a A T 10: 62,304,176 (GRCm39) D180E probably benign Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Xirp1 T G 9: 120,016,907 (GRCm38) Q970P probably benign Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h11a G A 1: 133,549,892 (GRCm39) P695S probably benign Het
Zc3h11a C T 1: 133,552,359 (GRCm39) V583I probably benign Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,553,091 (GRCm39) probably benign Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Zp3r C A 1: 130,547,151 (GRCm39) E8D possibly damaging Het
Zp3r A G 1: 130,524,551 (GRCm39) L164P probably benign Het
Other mutations in Ptpn22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Ptpn22 APN 3 103,810,690 (GRCm39) missense probably benign 0.01
IGL01373:Ptpn22 APN 3 103,793,520 (GRCm39) missense probably damaging 0.99
IGL01943:Ptpn22 APN 3 103,793,652 (GRCm39) missense probably benign 0.02
IGL02092:Ptpn22 APN 3 103,784,637 (GRCm39) missense probably damaging 1.00
IGL02431:Ptpn22 APN 3 103,810,713 (GRCm39) missense probably benign 0.01
IGL02732:Ptpn22 APN 3 103,793,349 (GRCm39) missense probably damaging 0.98
IGL02738:Ptpn22 APN 3 103,781,382 (GRCm39) splice site probably benign
IGL03406:Ptpn22 APN 3 103,819,332 (GRCm39) missense probably benign 0.14
R0490:Ptpn22 UTSW 3 103,793,495 (GRCm39) missense probably damaging 1.00
R0494:Ptpn22 UTSW 3 103,767,771 (GRCm39) missense probably damaging 1.00
R0626:Ptpn22 UTSW 3 103,767,721 (GRCm39) start codon destroyed probably null 1.00
R0743:Ptpn22 UTSW 3 103,809,487 (GRCm39) missense probably damaging 1.00
R1441:Ptpn22 UTSW 3 103,781,563 (GRCm39) missense probably damaging 1.00
R1610:Ptpn22 UTSW 3 103,809,512 (GRCm39) splice site probably null
R1698:Ptpn22 UTSW 3 103,793,114 (GRCm39) missense probably benign 0.20
R1786:Ptpn22 UTSW 3 103,781,368 (GRCm39) missense probably damaging 0.99
R1919:Ptpn22 UTSW 3 103,784,054 (GRCm39) critical splice donor site probably null
R2045:Ptpn22 UTSW 3 103,781,337 (GRCm39) missense possibly damaging 0.61
R3977:Ptpn22 UTSW 3 103,780,957 (GRCm39) splice site probably benign
R4176:Ptpn22 UTSW 3 103,793,561 (GRCm39) missense probably benign 0.00
R4478:Ptpn22 UTSW 3 103,809,380 (GRCm39) intron probably benign
R5093:Ptpn22 UTSW 3 103,789,418 (GRCm39) missense probably benign 0.39
R5579:Ptpn22 UTSW 3 103,789,455 (GRCm39) splice site probably null
R6022:Ptpn22 UTSW 3 103,793,421 (GRCm39) missense probably benign 0.00
R6110:Ptpn22 UTSW 3 103,819,331 (GRCm39) missense probably damaging 0.96
R6387:Ptpn22 UTSW 3 103,792,702 (GRCm39) missense probably benign 0.18
R7335:Ptpn22 UTSW 3 103,793,335 (GRCm39) missense probably damaging 0.97
R7516:Ptpn22 UTSW 3 103,792,854 (GRCm39) missense probably benign 0.16
R7523:Ptpn22 UTSW 3 103,819,331 (GRCm39) missense probably damaging 0.96
R7583:Ptpn22 UTSW 3 103,809,430 (GRCm39) missense probably benign 0.11
R8129:Ptpn22 UTSW 3 103,797,600 (GRCm39) critical splice donor site probably null
R8141:Ptpn22 UTSW 3 103,793,643 (GRCm39) missense possibly damaging 0.67
R9039:Ptpn22 UTSW 3 103,819,551 (GRCm39) unclassified probably benign
R9511:Ptpn22 UTSW 3 103,792,913 (GRCm39) missense probably benign 0.37
R9790:Ptpn22 UTSW 3 103,795,842 (GRCm39) missense possibly damaging 0.60
R9791:Ptpn22 UTSW 3 103,795,842 (GRCm39) missense possibly damaging 0.60
Z1177:Ptpn22 UTSW 3 103,793,016 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGCTCAGAGGCCCAAGAATATCAAG -3'
(R):5'- TGCACTCACCAAGATGCGGTACTC -3'

Sequencing Primer
(F):5'- CTTAATCTTAGAATGCTTCACTGGC -3'
(R):5'- TCCTCCAGAAGTCCAGGAGAG -3'
Posted On 2014-05-23