Incidental Mutation 'R1785:Kmt2a'
ID196388
Institutional Source Beutler Lab
Gene Symbol Kmt2a
Ensembl Gene ENSMUSG00000002028
Gene Namelysine (K)-specific methyltransferase 2A
SynonymsMll1, HTRX1, ALL-1, Cxxc7, trithorax Drosophila, Mll, All1
MMRRC Submission 039816-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1785 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44803355-44881296 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 44819675 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002095] [ENSMUST00000114689]
Predicted Effect unknown
Transcript: ENSMUST00000002095
AA Change: T3112I
SMART Domains Protein: ENSMUSP00000002095
Gene: ENSMUSG00000002028
AA Change: T3112I

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1624 7.94e-8 SMART
BROMO 1632 1766 2.24e-10 SMART
low complexity region 1816 1850 N/A INTRINSIC
PHD 1931 1977 1.74e-4 SMART
low complexity region 1990 2001 N/A INTRINSIC
FYRN 2029 2072 2.33e-20 SMART
low complexity region 2180 2194 N/A INTRINSIC
low complexity region 2215 2227 N/A INTRINSIC
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2789 2800 N/A INTRINSIC
low complexity region 2824 2833 N/A INTRINSIC
low complexity region 2856 2878 N/A INTRINSIC
low complexity region 2902 2909 N/A INTRINSIC
low complexity region 3115 3141 N/A INTRINSIC
low complexity region 3164 3175 N/A INTRINSIC
low complexity region 3228 3239 N/A INTRINSIC
low complexity region 3299 3312 N/A INTRINSIC
low complexity region 3342 3351 N/A INTRINSIC
low complexity region 3405 3419 N/A INTRINSIC
low complexity region 3498 3526 N/A INTRINSIC
low complexity region 3620 3633 N/A INTRINSIC
FYRC 3662 3747 8.54e-37 SMART
SET 3823 3945 6.09e-45 SMART
PostSET 3947 3963 1.65e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114689
AA Change: T3115I
SMART Domains Protein: ENSMUSP00000110337
Gene: ENSMUSG00000002028
AA Change: T3115I

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1627 9.12e-8 SMART
BROMO 1635 1769 2.24e-10 SMART
low complexity region 1819 1853 N/A INTRINSIC
PHD 1934 1980 1.74e-4 SMART
low complexity region 1993 2004 N/A INTRINSIC
FYRN 2032 2075 2.33e-20 SMART
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2218 2230 N/A INTRINSIC
low complexity region 2610 2621 N/A INTRINSIC
low complexity region 2792 2803 N/A INTRINSIC
low complexity region 2827 2836 N/A INTRINSIC
low complexity region 2859 2881 N/A INTRINSIC
low complexity region 2905 2912 N/A INTRINSIC
low complexity region 3118 3144 N/A INTRINSIC
low complexity region 3167 3178 N/A INTRINSIC
low complexity region 3231 3242 N/A INTRINSIC
low complexity region 3302 3315 N/A INTRINSIC
low complexity region 3345 3354 N/A INTRINSIC
low complexity region 3408 3422 N/A INTRINSIC
low complexity region 3501 3529 N/A INTRINSIC
low complexity region 3623 3636 N/A INTRINSIC
FYRC 3665 3750 8.54e-37 SMART
SET 3826 3948 6.09e-45 SMART
PostSET 3950 3966 1.65e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138119
AA Change: T147I
Predicted Effect probably benign
Transcript: ENSMUST00000152241
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-14.5 with edematous bodies, petechiae, and hematopoietic insufficiency. Heterozygotes show reduced growth, hematopoietic abnormalities, and homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 243 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn11 A G 17: 45,638,697 S448P probably benign Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cbx5 G A 15: 103,213,124 R29C probably null Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cfh T C 1: 140,136,788 K374R probably benign Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Cntnap5c A G 17: 58,162,291 I623V probably benign Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Daxx T C 17: 33,911,842 I277T probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dnah8 T C 17: 30,722,937 V1719A probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Enah A T 1: 181,956,429 M105K unknown Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Eya1 A G 1: 14,170,974 V573A probably benign Het
Faim2 A G 15: 99,512,542 L235P probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fcamr A G 1: 130,804,569 R98G probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gabarap C T 11: 69,991,689 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm10563 C T 4: 155,635,880 probably benign Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Grm7 G C 6: 111,358,295 D556H probably damaging Het
H2-K1 C A 17: 33,997,348 E275* probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,281 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mki67 T A 7: 135,704,241 probably null Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr195 A G 16: 59,149,297 Y149C probably damaging Het
Olfr279 A T 15: 98,497,835 D121V probably damaging Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr372 A G 8: 72,058,436 Y252C probably damaging Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pbx1 T G 1: 168,431,378 I43L probably benign Het
Phf2 T C 13: 48,817,567 D543G unknown Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pkd1 T C 17: 24,591,099 V3558A probably benign Het
Pla2g6 T C 15: 79,306,345 Y339C probably benign Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppard T G 17: 28,298,481 probably null Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Ppm1f A G 16: 16,910,970 T79A probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Pus7l T C 15: 94,540,637 N109S probably benign Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Ripk4 A C 16: 97,750,131 V149G probably damaging Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Rora G A 9: 69,376,837 A396T probably benign Het
Scap C T 9: 110,374,055 L266F probably damaging Het
Scn5a A T 9: 119,521,129 I893N probably damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G T 1: 120,063,246 E453D probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slc9a9 A T 9: 95,019,193 N393I possibly damaging Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Synj1 G T 16: 90,964,517 A687D probably damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tbx1 A C 16: 18,585,129 F138V probably damaging Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Trappc8 A G 18: 20,834,940 probably null Het
Trim33 AGACTG A 3: 103,329,220 probably null Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ttn A C 2: 76,885,926 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Vmn2r55 A T 7: 12,668,184 D392E probably damaging Het
Vps13b A G 15: 35,879,791 Y3004C probably damaging Het
Vps26a A T 10: 62,468,397 D180E probably benign Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Kmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kmt2a APN 9 44807934 unclassified probably benign
IGL00667:Kmt2a APN 9 44824386 utr 3 prime probably benign
IGL00828:Kmt2a APN 9 44820776 unclassified probably benign
IGL01080:Kmt2a APN 9 44809092 missense unknown
IGL01131:Kmt2a APN 9 44821170 unclassified probably benign
IGL01294:Kmt2a APN 9 44820297 unclassified probably benign
IGL01432:Kmt2a APN 9 44809096 missense unknown
IGL01646:Kmt2a APN 9 44825484 utr 3 prime probably benign
IGL01777:Kmt2a APN 9 44849005 missense probably damaging 0.99
IGL01944:Kmt2a APN 9 44849767 missense probably damaging 1.00
IGL02125:Kmt2a APN 9 44848686 missense probably damaging 1.00
IGL02207:Kmt2a APN 9 44847682 missense probably damaging 0.98
IGL02424:Kmt2a APN 9 44824635 utr 3 prime probably benign
IGL02499:Kmt2a APN 9 44830509 splice site probably benign
IGL02574:Kmt2a APN 9 44830513 splice site probably benign
IGL02711:Kmt2a APN 9 44824523 splice site probably benign
IGL02828:Kmt2a APN 9 44821947 unclassified probably benign
IGL03012:Kmt2a APN 9 44810966 unclassified probably benign
IGL03242:Kmt2a APN 9 44848392 missense probably damaging 0.99
IGL03294:Kmt2a APN 9 44820565 unclassified probably benign
IGL03326:Kmt2a APN 9 44818747 nonsense probably null
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0180:Kmt2a UTSW 9 44826851 utr 3 prime probably benign
R0363:Kmt2a UTSW 9 44809713 critical splice donor site probably null
R0411:Kmt2a UTSW 9 44819964 unclassified probably benign
R0555:Kmt2a UTSW 9 44847571 missense probably damaging 1.00
R0587:Kmt2a UTSW 9 44847534 missense probably damaging 0.99
R0865:Kmt2a UTSW 9 44818770 unclassified probably benign
R0988:Kmt2a UTSW 9 44848549 missense probably benign 0.03
R1006:Kmt2a UTSW 9 44847696 missense probably damaging 0.99
R1108:Kmt2a UTSW 9 44849062 missense probably damaging 1.00
R1292:Kmt2a UTSW 9 44814694 utr 3 prime probably benign
R1322:Kmt2a UTSW 9 44821121 unclassified probably benign
R1476:Kmt2a UTSW 9 44824635 utr 3 prime probably benign
R1485:Kmt2a UTSW 9 44826928 utr 3 prime probably benign
R1487:Kmt2a UTSW 9 44833990 utr 3 prime probably benign
R1493:Kmt2a UTSW 9 44846905 missense probably damaging 1.00
R1499:Kmt2a UTSW 9 44848266 missense probably benign 0.36
R1507:Kmt2a UTSW 9 44818403 unclassified probably benign
R1603:Kmt2a UTSW 9 44841561 unclassified probably null
R1635:Kmt2a UTSW 9 44824369 utr 3 prime probably benign
R1662:Kmt2a UTSW 9 44836670 utr 3 prime probably benign
R1711:Kmt2a UTSW 9 44841621 missense unknown
R1786:Kmt2a UTSW 9 44819675 unclassified probably benign
R1919:Kmt2a UTSW 9 44820345 unclassified probably benign
R1964:Kmt2a UTSW 9 44820644 missense probably benign 0.23
R1965:Kmt2a UTSW 9 44821460 unclassified probably benign
R2029:Kmt2a UTSW 9 44818450 missense probably benign 0.23
R2054:Kmt2a UTSW 9 44823374 utr 3 prime probably benign
R2259:Kmt2a UTSW 9 44881142 unclassified probably benign
R2382:Kmt2a UTSW 9 44820910 unclassified probably benign
R2483:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3033:Kmt2a UTSW 9 44821863 unclassified probably benign
R3423:Kmt2a UTSW 9 44820097 unclassified probably benign
R3428:Kmt2a UTSW 9 44848119 missense probably benign 0.06
R3605:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3607:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3611:Kmt2a UTSW 9 44822466 unclassified probably benign
R3623:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3745:Kmt2a UTSW 9 44831340 utr 3 prime probably benign
R3806:Kmt2a UTSW 9 44820356 unclassified probably benign
R3841:Kmt2a UTSW 9 44831291 utr 3 prime probably benign
R3855:Kmt2a UTSW 9 44830499 utr 3 prime probably benign
R4027:Kmt2a UTSW 9 44836693 utr 3 prime probably benign
R4124:Kmt2a UTSW 9 44819796 unclassified probably benign
R4177:Kmt2a UTSW 9 44820983 unclassified probably benign
R4296:Kmt2a UTSW 9 44821175 unclassified probably benign
R4414:Kmt2a UTSW 9 44809780 unclassified probably benign
R4461:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R4668:Kmt2a UTSW 9 44824572 utr 3 prime probably benign
R4761:Kmt2a UTSW 9 44849124 missense probably damaging 1.00
R4812:Kmt2a UTSW 9 44831354 utr 3 prime probably benign
R4815:Kmt2a UTSW 9 44821256 unclassified probably benign
R4817:Kmt2a UTSW 9 44821466 unclassified probably benign
R4888:Kmt2a UTSW 9 44821680 unclassified probably benign
R4958:Kmt2a UTSW 9 44848467 missense probably damaging 1.00
R5055:Kmt2a UTSW 9 44818352 unclassified probably benign
R5065:Kmt2a UTSW 9 44842700 unclassified probably benign
R5185:Kmt2a UTSW 9 44820246 unclassified probably benign
R5358:Kmt2a UTSW 9 44819274 unclassified probably benign
R5411:Kmt2a UTSW 9 44848485 missense probably damaging 1.00
R5420:Kmt2a UTSW 9 44848336 missense probably damaging 1.00
R5483:Kmt2a UTSW 9 44824624 utr 3 prime probably benign
R5487:Kmt2a UTSW 9 44821975 unclassified probably benign
R5488:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5489:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5538:Kmt2a UTSW 9 44820342 unclassified probably benign
R5576:Kmt2a UTSW 9 44842634 missense possibly damaging 0.94
R5631:Kmt2a UTSW 9 44820688 unclassified probably benign
R5781:Kmt2a UTSW 9 44847842 nonsense probably null
R5789:Kmt2a UTSW 9 44819904 unclassified probably benign
R5932:Kmt2a UTSW 9 44820647 unclassified probably benign
R6027:Kmt2a UTSW 9 44819290 unclassified probably benign
R6191:Kmt2a UTSW 9 44826828 utr 3 prime probably benign
R6239:Kmt2a UTSW 9 44819796 unclassified probably benign
R6291:Kmt2a UTSW 9 44832874 utr 3 prime probably benign
R6344:Kmt2a UTSW 9 44821859 unclassified probably benign
R6611:Kmt2a UTSW 9 44849272 missense probably damaging 0.98
R6641:Kmt2a UTSW 9 44819835 unclassified probably benign
R6651:Kmt2a UTSW 9 44828811 nonsense probably null
R6825:Kmt2a UTSW 9 44818407 unclassified probably benign
R6853:Kmt2a UTSW 9 44818407 unclassified probably benign
R6897:Kmt2a UTSW 9 44847645 missense probably benign 0.03
R6930:Kmt2a UTSW 9 44842665 unclassified probably benign
R6932:Kmt2a UTSW 9 44829261 utr 3 prime probably benign
R6957:Kmt2a UTSW 9 44820022 unclassified probably benign
X0021:Kmt2a UTSW 9 44831235 utr 3 prime probably benign
X0025:Kmt2a UTSW 9 44825392 nonsense probably null
X0026:Kmt2a UTSW 9 44820906 unclassified probably benign
X0027:Kmt2a UTSW 9 44880896 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTGAACCCAGAAGTTGGGGATCG -3'
(R):5'- CGTCCAGAACCAGAAGTATGTGCC -3'

Sequencing Primer
(F):5'- AGGCTGGACCCCAATGAG -3'
(R):5'- AGAAGTATGTGCCCAGTTCC -3'
Posted On2014-05-23