Incidental Mutation 'R1785:Scap'
ID196391
Institutional Source Beutler Lab
Gene Symbol Scap
Ensembl Gene ENSMUSG00000032485
Gene NameSREBF chaperone
Synonyms
MMRRC Submission 039816-MU
Accession Numbers

Genbank: NM_001001144; MGI: 2135958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1785 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110333288-110384950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110374055 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 266 (L266F)
Ref Sequence ENSEMBL: ENSMUSP00000095953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098350] [ENSMUST00000197630] [ENSMUST00000198976]
Predicted Effect probably damaging
Transcript: ENSMUST00000098350
AA Change: L266F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485
AA Change: L266F

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196775
Predicted Effect probably benign
Transcript: ENSMUST00000197630
SMART Domains Protein: ENSMUSP00000142919
Gene: ENSMUSG00000032485

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198976
SMART Domains Protein: ENSMUSP00000143369
Gene: ENSMUSG00000032485

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199886
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The SREBPs are then proteolytically cleaved and regulate sterol biosynthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, other(1) Gene trapped(22)

Other mutations in this stock
Total: 243 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn11 A G 17: 45,638,697 S448P probably benign Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cbx5 G A 15: 103,213,124 R29C probably null Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cfh T C 1: 140,136,788 K374R probably benign Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Cntnap5c A G 17: 58,162,291 I623V probably benign Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Daxx T C 17: 33,911,842 I277T probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dnah8 T C 17: 30,722,937 V1719A probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Enah A T 1: 181,956,429 M105K unknown Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Eya1 A G 1: 14,170,974 V573A probably benign Het
Faim2 A G 15: 99,512,542 L235P probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fcamr A G 1: 130,804,569 R98G probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gabarap C T 11: 69,991,689 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm10563 C T 4: 155,635,880 probably benign Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Grm7 G C 6: 111,358,295 D556H probably damaging Het
H2-K1 C A 17: 33,997,348 E275* probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,281 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Kmt2a G A 9: 44,819,675 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mki67 T A 7: 135,704,241 probably null Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr195 A G 16: 59,149,297 Y149C probably damaging Het
Olfr279 A T 15: 98,497,835 D121V probably damaging Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr372 A G 8: 72,058,436 Y252C probably damaging Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pbx1 T G 1: 168,431,378 I43L probably benign Het
Phf2 T C 13: 48,817,567 D543G unknown Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pkd1 T C 17: 24,591,099 V3558A probably benign Het
Pla2g6 T C 15: 79,306,345 Y339C probably benign Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppard T G 17: 28,298,481 probably null Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Ppm1f A G 16: 16,910,970 T79A probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Pus7l T C 15: 94,540,637 N109S probably benign Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Ripk4 A C 16: 97,750,131 V149G probably damaging Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Rora G A 9: 69,376,837 A396T probably benign Het
Scn5a A T 9: 119,521,129 I893N probably damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G T 1: 120,063,246 E453D probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slc9a9 A T 9: 95,019,193 N393I possibly damaging Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Synj1 G T 16: 90,964,517 A687D probably damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tbx1 A C 16: 18,585,129 F138V probably damaging Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Trappc8 A G 18: 20,834,940 probably null Het
Trim33 AGACTG A 3: 103,329,220 probably null Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ttn A C 2: 76,885,926 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Vmn2r55 A T 7: 12,668,184 D392E probably damaging Het
Vps13b A G 15: 35,879,791 Y3004C probably damaging Het
Vps26a A T 10: 62,468,397 D180E probably benign Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Scap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Scap APN 9 110376631 missense probably damaging 1.00
IGL01012:Scap APN 9 110362420 missense probably damaging 1.00
IGL01487:Scap APN 9 110377734 critical splice donor site probably null
IGL01634:Scap APN 9 110378789 critical splice donor site probably null
IGL01725:Scap APN 9 110381554 unclassified probably benign
IGL01939:Scap APN 9 110379481 missense probably benign 0.02
IGL02106:Scap APN 9 110381656 unclassified probably benign
IGL02423:Scap APN 9 110378617 missense probably benign 0.02
IGL02487:Scap APN 9 110378690 missense probably benign 0.19
IGL02545:Scap APN 9 110378690 missense probably benign 0.19
IGL03226:Scap APN 9 110384267 missense possibly damaging 0.93
IGL03331:Scap APN 9 110380236 unclassified probably null
3-1:Scap UTSW 9 110372968 intron probably benign
R0027:Scap UTSW 9 110379730 missense probably benign 0.06
R0089:Scap UTSW 9 110372222 missense possibly damaging 0.81
R0742:Scap UTSW 9 110381259 missense probably damaging 1.00
R1416:Scap UTSW 9 110384773 missense probably damaging 1.00
R1996:Scap UTSW 9 110372971 intron probably benign
R2114:Scap UTSW 9 110381273 missense probably damaging 0.99
R2189:Scap UTSW 9 110377693 missense probably damaging 1.00
R2233:Scap UTSW 9 110381593 missense probably damaging 0.98
R2234:Scap UTSW 9 110381593 missense probably damaging 0.98
R2656:Scap UTSW 9 110374019 missense probably damaging 1.00
R3176:Scap UTSW 9 110374025 missense probably benign
R3237:Scap UTSW 9 110379582 missense probably damaging 0.96
R3276:Scap UTSW 9 110374025 missense probably benign
R3623:Scap UTSW 9 110380203 missense probably damaging 0.99
R3826:Scap UTSW 9 110381297 missense probably benign
R4859:Scap UTSW 9 110374342 unclassified probably benign
R4993:Scap UTSW 9 110378390 missense probably damaging 1.00
R5052:Scap UTSW 9 110353152 missense possibly damaging 0.89
R5330:Scap UTSW 9 110381633 missense probably benign 0.00
R5331:Scap UTSW 9 110381633 missense probably benign 0.00
R5383:Scap UTSW 9 110374529 missense probably damaging 0.99
R5410:Scap UTSW 9 110374182 unclassified probably null
R5531:Scap UTSW 9 110381429 missense possibly damaging 0.59
R5567:Scap UTSW 9 110377644 missense probably damaging 1.00
R5636:Scap UTSW 9 110380594 missense probably damaging 0.99
R5637:Scap UTSW 9 110381572 missense possibly damaging 0.94
R5859:Scap UTSW 9 110374047 missense probably benign 0.14
R5923:Scap UTSW 9 110383580 missense probably damaging 0.98
R5945:Scap UTSW 9 110384596 missense probably benign 0.00
R5987:Scap UTSW 9 110381151 missense probably damaging 1.00
R6075:Scap UTSW 9 110378777 missense probably damaging 1.00
R6130:Scap UTSW 9 110380379 missense possibly damaging 0.95
R6190:Scap UTSW 9 110374067 missense probably benign 0.01
R6567:Scap UTSW 9 110383562 missense probably damaging 1.00
X0064:Scap UTSW 9 110377645 missense probably damaging 1.00
Z1088:Scap UTSW 9 110372336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCGTCATCATCCTTGTGG -3'
(R):5'- TTTCCTCAGCAGCCCCTGAGAATC -3'

Sequencing Primer
(F):5'- GTACCTGTGGAGACTAGAGAGATG -3'
(R):5'- AGATATGCTCTGGGCTCCAAG -3'
Posted On2014-05-23