Incidental Mutation 'R0080:Med23'
ID19644
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 038367-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0080 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24912817 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1368 (V1368A)
Ref Sequence ENSEMBL: ENSMUSP00000020159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000020161] [ENSMUST00000092646] [ENSMUST00000176285]
Predicted Effect probably benign
Transcript: ENSMUST00000020159
AA Change: V1368A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: V1368A

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020161
SMART Domains Protein: ENSMUSP00000020161
Gene: ENSMUSG00000019987

DomainStartEndE-ValueType
Pfam:Arginase 6 305 1.4e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092646
AA Change: V1374A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: V1374A

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176285
AA Change: V1008A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: V1008A

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218260
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 93.1%
  • 20x: 79.7%
Validation Efficiency 88% (175/200)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,794,578 probably null Het
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Adgb T C 10: 10,377,839 probably benign Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Coro7 A T 16: 4,630,464 L714Q probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Dsg1b T G 18: 20,397,367 S360A probably damaging Het
Ednra T C 8: 77,675,059 I201V probably benign Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Ggt6 A G 11: 72,437,195 T136A possibly damaging Het
Gnb5 A T 9: 75,314,354 E28V possibly damaging Het
Golgb1 T C 16: 36,898,611 L293P probably damaging Het
Gpr179 A G 11: 97,351,469 V183A probably benign Het
Grk6 T C 13: 55,458,910 S474P probably benign Het
Hectd4 A G 5: 121,349,372 S3477G probably benign Het
Irx3 T C 8: 91,800,326 D250G possibly damaging Het
Jsrp1 T G 10: 80,810,515 M70L probably benign Het
Kcmf1 G T 6: 72,850,487 probably null Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nos1 G T 5: 117,893,878 C297F probably damaging Het
Oas1d G A 5: 120,916,892 A176T possibly damaging Het
Odf2l A T 3: 145,124,323 I19F possibly damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pfkfb2 A T 1: 130,714,542 S5R probably benign Het
Pign G T 1: 105,552,405 A848E probably damaging Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ryr2 T A 13: 11,568,475 K4764N probably damaging Het
Scgb1b19 A G 7: 33,287,642 T73A probably damaging Het
Slc35d3 T C 10: 19,849,198 E304G probably damaging Het
Snta1 A G 2: 154,383,837 V209A probably benign Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tigd4 A G 3: 84,594,145 H123R probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trim60 C T 8: 65,000,599 A333T probably damaging Het
Vmn2r82 A T 10: 79,396,505 R779S probably benign Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAAGAATTGTGTGCCAGCTCCC -3'
(R):5'- TGTTCCAAGTGAAGTACAAGGCCC -3'

Sequencing Primer
(F):5'- GATGTCACTCCGTAAATGTGGAC -3'
(R):5'- GTGCCTAGTAAAAGCCACTTG -3'
Posted On2013-04-11