Incidental Mutation 'R1785:Dnah8'
ID 196442
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Name dynein, axonemal, heavy chain 8
Synonyms Dnahc8, P1-Loop, Hst6.7b
MMRRC Submission 039816-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R1785 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 30624354-30875264 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30722937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1719 (V1719A)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000170651
AA Change: V1719A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: V1719A

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 243 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn11 A G 17: 45,638,697 S448P probably benign Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cbx5 G A 15: 103,213,124 R29C probably null Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cfh T C 1: 140,136,788 K374R probably benign Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Cntnap5c A G 17: 58,162,291 I623V probably benign Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Daxx T C 17: 33,911,842 I277T probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Enah A T 1: 181,956,429 M105K unknown Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Eya1 A G 1: 14,170,974 V573A probably benign Het
Faim2 A G 15: 99,512,542 L235P probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fcamr A G 1: 130,804,569 R98G probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gabarap C T 11: 69,991,689 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm10563 C T 4: 155,635,880 probably benign Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Grm7 G C 6: 111,358,295 D556H probably damaging Het
H2-K1 C A 17: 33,997,348 E275* probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,281 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Kmt2a G A 9: 44,819,675 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mki67 T A 7: 135,704,241 probably null Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr195 A G 16: 59,149,297 Y149C probably damaging Het
Olfr279 A T 15: 98,497,835 D121V probably damaging Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr372 A G 8: 72,058,436 Y252C probably damaging Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pbx1 T G 1: 168,431,378 I43L probably benign Het
Phf2 T C 13: 48,817,567 D543G unknown Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pkd1 T C 17: 24,591,099 V3558A probably benign Het
Pla2g6 T C 15: 79,306,345 Y339C probably benign Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppard T G 17: 28,298,481 probably null Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Ppm1f A G 16: 16,910,970 T79A probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Pus7l T C 15: 94,540,637 N109S probably benign Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Ripk4 A C 16: 97,750,131 V149G probably damaging Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Rora G A 9: 69,376,837 A396T probably benign Het
Scap C T 9: 110,374,055 L266F probably damaging Het
Scn5a A T 9: 119,521,129 I893N probably damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G T 1: 120,063,246 E453D probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slc9a9 A T 9: 95,019,193 N393I possibly damaging Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Synj1 G T 16: 90,964,517 A687D probably damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tbx1 A C 16: 18,585,129 F138V probably damaging Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Trappc8 A G 18: 20,834,940 probably null Het
Trim33 AGACTG A 3: 103,329,220 probably null Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ttn A C 2: 76,885,926 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Vmn2r55 A T 7: 12,668,184 D392E probably damaging Het
Vps13b A G 15: 35,879,791 Y3004C probably damaging Het
Vps26a A T 10: 62,468,397 D180E probably benign Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30677176 missense probably benign 0.06
IGL00508:Dnah8 APN 17 30855930 missense probably damaging 1.00
IGL00547:Dnah8 APN 17 30815703 nonsense probably null
IGL00551:Dnah8 APN 17 30663478 nonsense probably null
IGL00732:Dnah8 APN 17 30656641 missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30767906 nonsense probably null
IGL00840:Dnah8 APN 17 30790941 missense probably damaging 1.00
IGL00845:Dnah8 APN 17 30819276 critical splice donor site probably null
IGL00953:Dnah8 APN 17 30706457 nonsense probably null
IGL00976:Dnah8 APN 17 30851710 missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30636005 missense probably benign 0.06
IGL01467:Dnah8 APN 17 30779916 missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30683714 splice site probably benign
IGL01515:Dnah8 APN 17 30648485 missense probably benign
IGL01723:Dnah8 APN 17 30708471 missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30751591 critical splice donor site probably null
IGL01921:Dnah8 APN 17 30736141 missense probably benign
IGL01958:Dnah8 APN 17 30855895 splice site probably benign
IGL01968:Dnah8 APN 17 30656598 nonsense probably null
IGL02093:Dnah8 APN 17 30717880 missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30648417 missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 30794763 missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30706513 critical splice donor site probably null
IGL02236:Dnah8 APN 17 30649773 nonsense probably null
IGL02259:Dnah8 APN 17 30759614 missense probably benign
IGL02263:Dnah8 APN 17 30729165 missense probably benign 0.00
IGL02303:Dnah8 APN 17 30713047 missense probably benign 0.03
IGL02341:Dnah8 APN 17 30747257 missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02377:Dnah8 APN 17 30794796 missense probably damaging 0.98
IGL02390:Dnah8 APN 17 30830845 missense probably benign 0.01
IGL02392:Dnah8 APN 17 30818051 splice site probably benign
IGL02414:Dnah8 APN 17 30700413 missense probably benign
IGL02455:Dnah8 APN 17 30672334 missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30668295 missense probably benign
IGL02831:Dnah8 APN 17 30712276 missense probably benign 0.23
IGL02863:Dnah8 APN 17 30769697 missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30721110 nonsense probably null
IGL02954:Dnah8 APN 17 30704835 missense probably benign 0.30
IGL02964:Dnah8 APN 17 30746761 missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30719006 missense probably benign 0.01
IGL03081:Dnah8 APN 17 30686373 splice site probably benign
IGL03086:Dnah8 APN 17 30742780 missense probably damaging 1.00
IGL03087:Dnah8 APN 17 30784144 missense probably benign
IGL03176:Dnah8 APN 17 30694037 missense probably benign
IGL03191:Dnah8 APN 17 30726830 missense probably damaging 0.99
IGL03210:Dnah8 APN 17 30815665 missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30673920 splice site probably null
IGL03255:Dnah8 APN 17 30741381 missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30672349 missense probably benign
IGL03348:Dnah8 APN 17 30746986 missense probably damaging 0.99
Alternator UTSW 17 30765635 missense probably benign
armature UTSW 17 30708390 missense probably benign 0.02
Brush UTSW 17 30746990 missense probably damaging 1.00
Dynos UTSW 17 30715509 missense possibly damaging 0.84
joule UTSW 17 30713098 critical splice donor site probably null
solenoid UTSW 17 30741178 missense probably damaging 1.00
FR4340:Dnah8 UTSW 17 30635463 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635465 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635477 small deletion probably benign
I2288:Dnah8 UTSW 17 30663454 missense probably benign
P0029:Dnah8 UTSW 17 30765720 missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30708445 missense probably benign 0.04
R0016:Dnah8 UTSW 17 30663316 missense probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30755119 missense probably damaging 1.00
R0090:Dnah8 UTSW 17 30784090 missense probably benign 0.20
R0119:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0184:Dnah8 UTSW 17 30683683 missense probably benign 0.04
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30690271 missense probably benign
R0268:Dnah8 UTSW 17 30769707 missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30736156 missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 30871351 missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30708390 missense probably benign 0.02
R0423:Dnah8 UTSW 17 30701981 missense probably benign
R0470:Dnah8 UTSW 17 30708540 splice site probably benign
R0477:Dnah8 UTSW 17 30755080 missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30700419 missense probably benign
R0499:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30718961 missense probably benign 0.01
R0601:Dnah8 UTSW 17 30708358 missense probably benign 0.06
R0646:Dnah8 UTSW 17 30684173 missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30736155 missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30704662 missense probably benign
R0843:Dnah8 UTSW 17 30813095 missense probably damaging 1.00
R0940:Dnah8 UTSW 17 30803243 missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30673920 splice site probably null
R1102:Dnah8 UTSW 17 30854764 splice site probably null
R1137:Dnah8 UTSW 17 30855936 missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30721000 missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30737295 missense probably damaging 1.00
R1377:Dnah8 UTSW 17 30840622 nonsense probably null
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1497:Dnah8 UTSW 17 30752075 missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30673888 missense probably benign
R1541:Dnah8 UTSW 17 30747247 missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30635664 missense probably benign 0.07
R1634:Dnah8 UTSW 17 30713098 critical splice donor site probably null
R1670:Dnah8 UTSW 17 30725124 missense probably damaging 1.00
R1710:Dnah8 UTSW 17 30854940 missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30769651 missense probably benign 0.28
R1761:Dnah8 UTSW 17 30779916 missense probably damaging 1.00
R1804:Dnah8 UTSW 17 30708407 missense probably benign 0.00
R1808:Dnah8 UTSW 17 30684186 missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30731180 missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 30874927 missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30635505 missense unknown
R1935:Dnah8 UTSW 17 30726896 splice site probably benign
R1940:Dnah8 UTSW 17 30731207 missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30712385 missense probably benign 0.00
R2025:Dnah8 UTSW 17 30731159 missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30758281 missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30635658 missense probably benign 0.01
R2148:Dnah8 UTSW 17 30737258 missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30653393 missense probably benign
R2180:Dnah8 UTSW 17 30840647 missense probably benign 0.00
R2262:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2328:Dnah8 UTSW 17 30794744 missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30771872 missense probably benign
R2357:Dnah8 UTSW 17 30874935 missense probably benign 0.00
R2360:Dnah8 UTSW 17 30677204 missense probably benign 0.22
R2496:Dnah8 UTSW 17 30851731 missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30741365 nonsense probably null
R2509:Dnah8 UTSW 17 30775045 missense probably benign 0.02
R3114:Dnah8 UTSW 17 30833568 missense probably benign 0.04
R3708:Dnah8 UTSW 17 30739657 missense probably damaging 0.98
R3720:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3722:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30739648 nonsense probably null
R3747:Dnah8 UTSW 17 30784174 nonsense probably null
R3748:Dnah8 UTSW 17 30784174 nonsense probably null
R3749:Dnah8 UTSW 17 30784174 nonsense probably null
R3787:Dnah8 UTSW 17 30755041 missense probably damaging 1.00
R3790:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30670647 missense probably benign 0.00
R3857:Dnah8 UTSW 17 30663422 missense probably damaging 0.96
R3898:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3899:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3938:Dnah8 UTSW 17 30854937 missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30694065 splice site probably benign
R4091:Dnah8 UTSW 17 30769839 missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30748559 missense probably benign
R4326:Dnah8 UTSW 17 30752092 missense probably benign 0.04
R4346:Dnah8 UTSW 17 30725098 missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30752146 missense probably damaging 1.00
R4457:Dnah8 UTSW 17 30813151 missense probably benign
R4475:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4565:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4566:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4568:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4573:Dnah8 UTSW 17 30700406 missense probably benign 0.00
R4580:Dnah8 UTSW 17 30662052 missense probably benign 0.00
R4585:Dnah8 UTSW 17 30751567 missense probably benign 0.01
R4611:Dnah8 UTSW 17 30684237 missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30683634 missense probably benign 0.08
R4721:Dnah8 UTSW 17 30725166 missense probably damaging 1.00
R4727:Dnah8 UTSW 17 30851747 missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4732:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4733:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4798:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4814:Dnah8 UTSW 17 30767924 missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4894:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4900:Dnah8 UTSW 17 30746975 missense probably damaging 1.00
R4901:Dnah8 UTSW 17 30840714 critical splice donor site probably null
R4913:Dnah8 UTSW 17 30819139 missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4932:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4933:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4942:Dnah8 UTSW 17 30729142 missense probably benign
R4969:Dnah8 UTSW 17 30723014 missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4977:Dnah8 UTSW 17 30663301 missense probably benign 0.00
R5001:Dnah8 UTSW 17 30787185 missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5013:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5014:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5024:Dnah8 UTSW 17 30736096 missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30739757 critical splice donor site probably null
R5075:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5075:Dnah8 UTSW 17 30800531 missense probably damaging 1.00
R5112:Dnah8 UTSW 17 30731038 missense probably benign 0.02
R5121:Dnah8 UTSW 17 30810353 missense probably benign 0.14
R5138:Dnah8 UTSW 17 30765597 missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30712295 missense probably benign 0.06
R5191:Dnah8 UTSW 17 30746765 missense probably damaging 1.00
R5238:Dnah8 UTSW 17 30790917 missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30700419 missense probably benign
R5358:Dnah8 UTSW 17 30746954 missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5404:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5482:Dnah8 UTSW 17 30800547 missense probably damaging 0.96
R5489:Dnah8 UTSW 17 30790956 missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30752916 missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30706386 missense probably benign 0.00
R5640:Dnah8 UTSW 17 30803108 missense probably damaging 1.00
R5649:Dnah8 UTSW 17 30800587 missense probably benign 0.13
R5662:Dnah8 UTSW 17 30737333 missense probably damaging 1.00
R5673:Dnah8 UTSW 17 30803261 missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5699:Dnah8 UTSW 17 30810324 missense probably benign 0.22
R5737:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5738:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5739:Dnah8 UTSW 17 30719007 missense probably benign 0.00
R5766:Dnah8 UTSW 17 30690261 missense probably benign 0.01
R5790:Dnah8 UTSW 17 30875004 missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30728191 missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 30794763 missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5886:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5887:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30656685 missense probably benign 0.32
R5979:Dnah8 UTSW 17 30815664 nonsense probably null
R5986:Dnah8 UTSW 17 30851630 missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30663305 missense probably benign 0.32
R6042:Dnah8 UTSW 17 30747265 missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6181:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6237:Dnah8 UTSW 17 30747854 nonsense probably null
R6239:Dnah8 UTSW 17 30810359 missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6365:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6416:Dnah8 UTSW 17 30765635 missense probably benign
R6443:Dnah8 UTSW 17 30771885 missense probably benign 0.10
R6478:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6479:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6480:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6481:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6533:Dnah8 UTSW 17 30746990 missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6608:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6610:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6675:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6723:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6724:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6754:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6755:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6759:Dnah8 UTSW 17 30663292 splice site probably null
R6765:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6766:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6778:Dnah8 UTSW 17 30635666 missense probably benign 0.00
R6781:Dnah8 UTSW 17 30765724 frame shift probably null
R6788:Dnah8 UTSW 17 30648465 missense probably benign 0.14
R6814:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30741173 missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30710551 missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30746959 missense probably damaging 1.00
R6944:Dnah8 UTSW 17 30794659 missense probably benign 0.09
R6982:Dnah8 UTSW 17 30767925 missense probably benign 0.03
R6984:Dnah8 UTSW 17 30739738 missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30662091 missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30643275 missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30704724 missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30741178 missense probably damaging 1.00
R7112:Dnah8 UTSW 17 30871392 missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30644617 missense probably benign 0.01
R7146:Dnah8 UTSW 17 30769644 missense possibly damaging 0.90
R7309:Dnah8 UTSW 17 30875014 missense probably damaging 1.00
R7324:Dnah8 UTSW 17 30784125 missense probably benign 0.01
R7373:Dnah8 UTSW 17 30767965 critical splice donor site probably null
R7423:Dnah8 UTSW 17 30704769 missense possibly damaging 0.86
R7430:Dnah8 UTSW 17 30706389 missense probably damaging 0.98
R7450:Dnah8 UTSW 17 30787191 missense probably damaging 0.99
R7580:Dnah8 UTSW 17 30775103 missense probably damaging 0.98
R7604:Dnah8 UTSW 17 30813095 missense probably damaging 1.00
R7635:Dnah8 UTSW 17 30785107 missense probably damaging 1.00
R7646:Dnah8 UTSW 17 30649677 missense probably benign 0.00
R7685:Dnah8 UTSW 17 30657973 missense probably damaging 1.00
R7793:Dnah8 UTSW 17 30855944 missense probably benign 0.20
R7827:Dnah8 UTSW 17 30760867 frame shift probably null
R7866:Dnah8 UTSW 17 30874927 missense possibly damaging 0.94
R7877:Dnah8 UTSW 17 30663374 missense probably benign
R7891:Dnah8 UTSW 17 30712289 missense probably benign 0.09
R7977:Dnah8 UTSW 17 30744524 missense probably damaging 1.00
R7987:Dnah8 UTSW 17 30744524 missense probably damaging 1.00
R8025:Dnah8 UTSW 17 30741337 nonsense probably null
R8076:Dnah8 UTSW 17 30784153 missense possibly damaging 0.94
R8170:Dnah8 UTSW 17 30673823 missense probably damaging 1.00
R8199:Dnah8 UTSW 17 30871419 missense probably benign 0.06
R8253:Dnah8 UTSW 17 30760867 frame shift probably null
R8270:Dnah8 UTSW 17 30840713 missense probably damaging 1.00
R8291:Dnah8 UTSW 17 30765727 missense probably damaging 1.00
R8334:Dnah8 UTSW 17 30769831 missense probably benign 0.12
R8348:Dnah8 UTSW 17 30673840 missense probably benign
R8348:Dnah8 UTSW 17 30736147 missense probably damaging 0.96
R8354:Dnah8 UTSW 17 30643260 missense probably benign 0.17
R8355:Dnah8 UTSW 17 30695178 missense possibly damaging 0.89
R8439:Dnah8 UTSW 17 30760867 frame shift probably null
R8448:Dnah8 UTSW 17 30673840 missense probably benign
R8459:Dnah8 UTSW 17 30725247 critical splice donor site probably null
R8462:Dnah8 UTSW 17 30656629 missense probably damaging 1.00
R8506:Dnah8 UTSW 17 30721134 missense probably benign
R8524:Dnah8 UTSW 17 30715498 missense possibly damaging 0.95
R8555:Dnah8 UTSW 17 30721110 nonsense probably null
R8698:Dnah8 UTSW 17 30875035 missense probably damaging 1.00
R8719:Dnah8 UTSW 17 30741315 missense probably damaging 0.97
R8778:Dnah8 UTSW 17 30760867 frame shift probably null
R8781:Dnah8 UTSW 17 30725104 missense probably damaging 1.00
R8821:Dnah8 UTSW 17 30794738 missense probably damaging 1.00
R8864:Dnah8 UTSW 17 30762642 missense possibly damaging 0.95
R8885:Dnah8 UTSW 17 30708312 missense possibly damaging 0.83
R8983:Dnah8 UTSW 17 30851654 missense probably damaging 0.98
R8994:Dnah8 UTSW 17 30790833 missense probably benign 0.05
R9031:Dnah8 UTSW 17 30737427 missense probably damaging 1.00
R9068:Dnah8 UTSW 17 30756755 missense possibly damaging 0.63
R9105:Dnah8 UTSW 17 30760867 frame shift probably null
R9127:Dnah8 UTSW 17 30760867 frame shift probably null
R9225:Dnah8 UTSW 17 30635673 missense probably benign 0.01
R9280:Dnah8 UTSW 17 30785097 missense possibly damaging 0.52
R9291:Dnah8 UTSW 17 30725125 missense probably damaging 1.00
R9314:Dnah8 UTSW 17 30771883 missense probably benign
R9347:Dnah8 UTSW 17 30708359 missense probably benign 0.00
R9393:Dnah8 UTSW 17 30653387 missense possibly damaging 0.53
R9415:Dnah8 UTSW 17 30810323 missense not run
RF027:Dnah8 UTSW 17 30635476 frame shift probably null
X0001:Dnah8 UTSW 17 30748680 missense probably damaging 1.00
X0013:Dnah8 UTSW 17 30819186 missense possibly damaging 0.71
Z1176:Dnah8 UTSW 17 30648540 missense probably benign
Z1177:Dnah8 UTSW 17 30694033 missense probably benign
Z1177:Dnah8 UTSW 17 30713095 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCCTTCTCACTGGTCTCTGG -3'
(R):5'- GCGTCCTGTCCCATAAAACCTTACC -3'

Sequencing Primer
(F):5'- TTTTGGAAATCAGTTCCCAGC -3'
(R):5'- tcacaaagtagcccagcaag -3'
Posted On 2014-05-23