Incidental Mutation 'R1770:Wdfy1'
ID196461
Institutional Source Beutler Lab
Gene Symbol Wdfy1
Ensembl Gene ENSMUSG00000073643
Gene NameWD repeat and FYVE domain containing 1
Synonyms1700120F24Rik, 1700013B03Rik, Jr1
MMRRC Submission 039801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1770 (G1)
Quality Score112
Status Validated
Chromosome1
Chromosomal Location79702262-79776143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79709140 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 296 (W296R)
Ref Sequence ENSEMBL: ENSMUSP00000109143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113512] [ENSMUST00000113513] [ENSMUST00000113514] [ENSMUST00000113515] [ENSMUST00000187005]
Predicted Effect probably damaging
Transcript: ENSMUST00000113512
AA Change: W296R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109140
Gene: ENSMUSG00000073643
AA Change: W296R

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
WD40 145 183 2.84e2 SMART
WD40 188 227 1.13e-7 SMART
WD40 231 270 1.22e-3 SMART
FYVE 276 353 3.95e-23 SMART
WD40 355 394 1.7e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113513
AA Change: W296R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109141
Gene: ENSMUSG00000073643
AA Change: W296R

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
WD40 145 183 2.84e2 SMART
WD40 188 227 1.13e-7 SMART
WD40 231 270 1.22e-3 SMART
FYVE 276 353 3.95e-23 SMART
WD40 355 394 1.7e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113514
AA Change: W296R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109142
Gene: ENSMUSG00000073643
AA Change: W296R

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
WD40 145 183 2.84e2 SMART
WD40 188 227 1.13e-7 SMART
WD40 231 270 1.22e-3 SMART
FYVE 276 353 3.95e-23 SMART
WD40 355 394 1.7e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113515
AA Change: W296R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109143
Gene: ENSMUSG00000073643
AA Change: W296R

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
WD40 145 183 2.84e2 SMART
WD40 188 227 1.13e-7 SMART
WD40 231 270 1.22e-3 SMART
FYVE 276 353 3.95e-23 SMART
WD40 355 394 1.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187005
SMART Domains Protein: ENSMUSP00000139961
Gene: ENSMUSG00000073643

DomainStartEndE-ValueType
WD40 13 52 3.2e-6 SMART
Blast:WD40 56 93 1e-21 BLAST
Meta Mutation Damage Score 0.8334 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylinositol 3-phosphate binding protein, which contains a FYVE zinc finger domain and multiple WD-40 repeat domains. When exogenously expressed, it localizes to early endosomes. Mutagenesis analysis demonstrates that this endosomal localization is mediated by the FYVE domain. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,418,021 T230S probably benign Het
Abcd4 T C 12: 84,615,100 T84A probably benign Het
Adgra1 T A 7: 139,874,031 Y161* probably null Het
Aldoart1 G T 4: 72,851,936 H212N probably benign Het
Aldob A G 4: 49,536,861 Y343H probably damaging Het
Ankrd17 A T 5: 90,243,376 V2036E possibly damaging Het
Ass1 A G 2: 31,486,516 T131A probably benign Het
Baz1a C T 12: 54,898,508 R1354H probably damaging Het
C2cd2l A G 9: 44,316,811 V71A probably benign Het
C4b T A 17: 34,736,927 N678I possibly damaging Het
Carmil1 A G 13: 24,173,674 L64P probably damaging Het
Cdh18 T C 15: 23,474,401 S786P probably benign Het
Cep135 A G 5: 76,603,195 E296G possibly damaging Het
Chml G A 1: 175,687,878 T159I probably benign Het
Cntn3 C T 6: 102,269,205 E328K possibly damaging Het
Cstf1 A G 2: 172,373,063 I35V possibly damaging Het
Cyp2c65 A G 19: 39,082,198 K275R probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbx2 T C 15: 95,624,734 E364G probably benign Het
Dcaf13 A T 15: 39,130,238 N242I probably damaging Het
Dcc A G 18: 71,446,399 V701A probably benign Het
Fastkd5 A T 2: 130,614,280 Y797N probably damaging Het
Fat4 T A 3: 39,010,268 I4791K probably damaging Het
Gm3852 T C 1: 46,011,888 I45V possibly damaging Het
Gng4 A G 13: 13,825,266 D40G probably damaging Het
Gns A G 10: 121,378,047 D209G probably benign Het
Kif6 C A 17: 49,903,649 Q791K possibly damaging Het
Klhl35 G A 7: 99,473,875 V569M possibly damaging Het
Krt2 A G 15: 101,811,154 S694P unknown Het
Lrrc8c A G 5: 105,606,737 Y126C probably damaging Het
Mad2l1bp A G 17: 46,152,912 V62A probably benign Het
Map1b T C 13: 99,430,493 R1907G unknown Het
Mertk A G 2: 128,750,174 I273V probably benign Het
Mfsd4b1 A G 10: 40,003,227 Y225H probably damaging Het
Mrc2 T C 11: 105,338,793 V684A probably damaging Het
Msh6 G A 17: 87,980,223 W97* probably null Het
Mtmr10 A G 7: 64,336,721 I516V possibly damaging Het
Myo7a A T 7: 98,112,606 probably benign Het
Ndufs5 T C 4: 123,712,868 Y92C probably benign Het
Nlrp1b C T 11: 71,160,153 V1035I probably benign Het
Ntrk2 A G 13: 58,861,318 R308G possibly damaging Het
Olfr1148 A G 2: 87,833,299 I87V probably benign Het
Pcdhb16 G T 18: 37,479,180 G398W probably damaging Het
Plpbp T A 8: 27,053,298 S237T probably damaging Het
Pnpla6 T A 8: 3,534,634 F769I possibly damaging Het
Polk A G 13: 96,495,442 V261A probably damaging Het
Prss52 C T 14: 64,113,633 A289V probably damaging Het
Puf60 T C 15: 76,070,874 K407E probably benign Het
Pzp T C 6: 128,485,617 D1455G probably damaging Het
Ranbp17 T C 11: 33,217,301 N1054S probably benign Het
Sdk2 A G 11: 113,793,741 S1965P probably benign Het
Spryd7 T C 14: 61,540,205 Y142C probably damaging Het
Srrt A T 5: 137,299,860 probably benign Het
Stk10 A G 11: 32,622,464 E935G possibly damaging Het
Tas2r115 G A 6: 132,737,971 R6C probably damaging Het
Tdrd7 T A 4: 45,987,681 probably benign Het
Trim29 A T 9: 43,332,376 Q564L probably damaging Het
Trim5 T C 7: 104,276,661 D231G probably damaging Het
Trpv2 A G 11: 62,596,961 K676E probably benign Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a2 A G 1: 88,201,438 I268V probably benign Het
Ugt8a T C 3: 125,874,203 N330D probably benign Het
Utrn G A 10: 12,475,296 H2822Y probably damaging Het
Vmn1r176 G A 7: 23,835,521 A69V probably benign Het
Vmn2r106 T C 17: 20,268,298 Y613C probably damaging Het
Zfp11 G A 5: 129,657,758 T213I possibly damaging Het
Zfp142 A T 1: 74,579,631 F193I probably damaging Het
Zfp764 G A 7: 127,405,567 Q131* probably null Het
Other mutations in Wdfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Wdfy1 APN 1 79713872 missense probably benign 0.00
IGL01473:Wdfy1 APN 1 79707465 missense probably benign 0.00
IGL01934:Wdfy1 APN 1 79740116 missense probably damaging 1.00
IGL02052:Wdfy1 APN 1 79714944 missense probably damaging 0.99
IGL02969:Wdfy1 APN 1 79713871 missense probably benign 0.09
IGL03077:Wdfy1 APN 1 79714905 missense possibly damaging 0.66
IGL03157:Wdfy1 APN 1 79706318 missense probably damaging 1.00
R1592:Wdfy1 UTSW 1 79706255 missense probably damaging 1.00
R1679:Wdfy1 UTSW 1 79707475 nonsense probably null
R2495:Wdfy1 UTSW 1 79707505 missense probably null 1.00
R3821:Wdfy1 UTSW 1 79706300 missense probably benign 0.00
R4431:Wdfy1 UTSW 1 79713866 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGTCATGCTCACTGTCAGTCAC -3'
(R):5'- AGTCACTTAGAAGCACACACGGATG -3'

Sequencing Primer
(F):5'- tcacctgcctctgcctc -3'
(R):5'- ggagcattgctaaaagtttcagg -3'
Posted On2014-05-23