Mutagenetix > Incidental Mutations

Incidental Mutation 'R1770:Mertk'

196467

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

039801-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R1770 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128750174 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 273 (I273V)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably benign
Transcript: ENSMUST00000014505
AA Change: I273V

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: I273V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145178

Meta Mutation Damage Score

0.0993

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.8%

Validation Efficiency

92% (69/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,418,021	T230S	probably benign	Het
Abcd4	T	C	12: 84,615,100	T84A	probably benign	Het
Adgra1	T	A	7: 139,874,031	Y161*	probably null	Het
Aldoart1	G	T	4: 72,851,936	H212N	probably benign	Het
Aldob	A	G	4: 49,536,861	Y343H	probably damaging	Het
Ankrd17	A	T	5: 90,243,376	V2036E	possibly damaging	Het
Ass1	A	G	2: 31,486,516	T131A	probably benign	Het
Baz1a	C	T	12: 54,898,508	R1354H	probably damaging	Het
C2cd2l	A	G	9: 44,316,811	V71A	probably benign	Het
C4b	T	A	17: 34,736,927	N678I	possibly damaging	Het
Carmil1	A	G	13: 24,173,674	L64P	probably damaging	Het
Cdh18	T	C	15: 23,474,401	S786P	probably benign	Het
Cep135	A	G	5: 76,603,195	E296G	possibly damaging	Het
Chml	G	A	1: 175,687,878	T159I	probably benign	Het
Cntn3	C	T	6: 102,269,205	E328K	possibly damaging	Het
Cstf1	A	G	2: 172,373,063	I35V	possibly damaging	Het
Cyp2c65	A	G	19: 39,082,198	K275R	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dbx2	T	C	15: 95,624,734	E364G	probably benign	Het
Dcaf13	A	T	15: 39,130,238	N242I	probably damaging	Het
Dcc	A	G	18: 71,446,399	V701A	probably benign	Het
Fastkd5	A	T	2: 130,614,280	Y797N	probably damaging	Het
Fat4	T	A	3: 39,010,268	I4791K	probably damaging	Het
Gm3852	T	C	1: 46,011,888	I45V	possibly damaging	Het
Gng4	A	G	13: 13,825,266	D40G	probably damaging	Het
Gns	A	G	10: 121,378,047	D209G	probably benign	Het
Kif6	C	A	17: 49,903,649	Q791K	possibly damaging	Het
Klhl35	G	A	7: 99,473,875	V569M	possibly damaging	Het
Krt2	A	G	15: 101,811,154	S694P	unknown	Het
Lrrc8c	A	G	5: 105,606,737	Y126C	probably damaging	Het
Mad2l1bp	A	G	17: 46,152,912	V62A	probably benign	Het
Map1b	T	C	13: 99,430,493	R1907G	unknown	Het
Mfsd4b1	A	G	10: 40,003,227	Y225H	probably damaging	Het
Mrc2	T	C	11: 105,338,793	V684A	probably damaging	Het
Msh6	G	A	17: 87,980,223	W97*	probably null	Het
Mtmr10	A	G	7: 64,336,721	I516V	possibly damaging	Het
Myo7a	A	T	7: 98,112,606		probably benign	Het
Ndufs5	T	C	4: 123,712,868	Y92C	probably benign	Het
Nlrp1b	C	T	11: 71,160,153	V1035I	probably benign	Het
Ntrk2	A	G	13: 58,861,318	R308G	possibly damaging	Het
Olfr1148	A	G	2: 87,833,299	I87V	probably benign	Het
Pcdhb16	G	T	18: 37,479,180	G398W	probably damaging	Het
Plpbp	T	A	8: 27,053,298	S237T	probably damaging	Het
Pnpla6	T	A	8: 3,534,634	F769I	possibly damaging	Het
Polk	A	G	13: 96,495,442	V261A	probably damaging	Het
Prss52	C	T	14: 64,113,633	A289V	probably damaging	Het
Puf60	T	C	15: 76,070,874	K407E	probably benign	Het
Pzp	T	C	6: 128,485,617	D1455G	probably damaging	Het
Ranbp17	T	C	11: 33,217,301	N1054S	probably benign	Het
Sdk2	A	G	11: 113,793,741	S1965P	probably benign	Het
Spryd7	T	C	14: 61,540,205	Y142C	probably damaging	Het
Srrt	A	T	5: 137,299,860		probably benign	Het
Stk10	A	G	11: 32,622,464	E935G	possibly damaging	Het
Tas2r115	G	A	6: 132,737,971	R6C	probably damaging	Het
Tdrd7	T	A	4: 45,987,681		probably benign	Het
Trim29	A	T	9: 43,332,376	Q564L	probably damaging	Het
Trim5	T	C	7: 104,276,661	D231G	probably damaging	Het
Trpv2	A	G	11: 62,596,961	K676E	probably benign	Het
Ttn	T	C	2: 76,753,515	R22383G	probably damaging	Het
Ugt1a2	A	G	1: 88,201,438	I268V	probably benign	Het
Ugt8a	T	C	3: 125,874,203	N330D	probably benign	Het
Utrn	G	A	10: 12,475,296	H2822Y	probably damaging	Het
Vmn1r176	G	A	7: 23,835,521	A69V	probably benign	Het
Vmn2r106	T	C	17: 20,268,298	Y613C	probably damaging	Het
Wdfy1	A	T	1: 79,709,140	W296R	probably damaging	Het
Zfp11	G	A	5: 129,657,758	T213I	possibly damaging	Het
Zfp142	A	T	1: 74,579,631	F193I	probably damaging	Het
Zfp764	G	A	7: 127,405,567	Q131*	probably null	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAAAGCTGCCAAAGCCACGGG -3'
(R):5'- ACGACCTATGTGCCAAGAACTGC -3'

Sequencing Primer
(F):5'- GGTCTCTAGCTCAGGACAATC -3'
(R):5'- TGTGCCAAGAACTGCTATGAC -3'

Posted On

2014-05-23