Incidental Mutation 'R1770:Cstf1'
ID196469
Institutional Source Beutler Lab
Gene Symbol Cstf1
Ensembl Gene ENSMUSG00000027498
Gene Namecleavage stimulation factor, 3' pre-RNA, subunit 1
Synonyms
MMRRC Submission 039801-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1770 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172370681-172382448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172373063 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 35 (I35V)
Ref Sequence ENSEMBL: ENSMUSP00000121178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028997] [ENSMUST00000109139] [ENSMUST00000109140] [ENSMUST00000116375] [ENSMUST00000151511]
Predicted Effect probably benign
Transcript: ENSMUST00000028997
SMART Domains Protein: ENSMUSP00000028997
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 146 396 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109139
SMART Domains Protein: ENSMUSP00000104767
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109140
SMART Domains Protein: ENSMUSP00000104768
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116375
AA Change: I35V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112076
Gene: ENSMUSG00000027498
AA Change: I35V

DomainStartEndE-ValueType
Pfam:CSTF1_dimer 6 62 5.4e-28 PFAM
WD40 97 136 2.61e-3 SMART
WD40 162 201 3.29e-9 SMART
WD40 206 245 6.88e0 SMART
WD40 248 290 9.02e-7 SMART
WD40 293 334 1.44e-5 SMART
Blast:WD40 337 382 8e-9 BLAST
WD40 385 425 2.49e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126107
Predicted Effect possibly damaging
Transcript: ENSMUST00000151511
AA Change: I35V

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121178
Gene: ENSMUSG00000027498
AA Change: I35V

DomainStartEndE-ValueType
PDB:2XZ2|A 8 59 2e-7 PDB
WD40 97 136 2.61e-3 SMART
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three subunits which combine to form cleavage stimulation factor (CSTF). CSTF is involved in the polyadenylation and 3'end cleavage of pre-mRNAs. Similar to mammalian G protein beta subunits, this protein contains transducin-like repeats. Several transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,418,021 T230S probably benign Het
Abcd4 T C 12: 84,615,100 T84A probably benign Het
Adgra1 T A 7: 139,874,031 Y161* probably null Het
Aldoart1 G T 4: 72,851,936 H212N probably benign Het
Aldob A G 4: 49,536,861 Y343H probably damaging Het
Ankrd17 A T 5: 90,243,376 V2036E possibly damaging Het
Ass1 A G 2: 31,486,516 T131A probably benign Het
Baz1a C T 12: 54,898,508 R1354H probably damaging Het
C2cd2l A G 9: 44,316,811 V71A probably benign Het
C4b T A 17: 34,736,927 N678I possibly damaging Het
Carmil1 A G 13: 24,173,674 L64P probably damaging Het
Cdh18 T C 15: 23,474,401 S786P probably benign Het
Cep135 A G 5: 76,603,195 E296G possibly damaging Het
Chml G A 1: 175,687,878 T159I probably benign Het
Cntn3 C T 6: 102,269,205 E328K possibly damaging Het
Cyp2c65 A G 19: 39,082,198 K275R probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbx2 T C 15: 95,624,734 E364G probably benign Het
Dcaf13 A T 15: 39,130,238 N242I probably damaging Het
Dcc A G 18: 71,446,399 V701A probably benign Het
Fastkd5 A T 2: 130,614,280 Y797N probably damaging Het
Fat4 T A 3: 39,010,268 I4791K probably damaging Het
Gm3852 T C 1: 46,011,888 I45V possibly damaging Het
Gng4 A G 13: 13,825,266 D40G probably damaging Het
Gns A G 10: 121,378,047 D209G probably benign Het
Kif6 C A 17: 49,903,649 Q791K possibly damaging Het
Klhl35 G A 7: 99,473,875 V569M possibly damaging Het
Krt2 A G 15: 101,811,154 S694P unknown Het
Lrrc8c A G 5: 105,606,737 Y126C probably damaging Het
Mad2l1bp A G 17: 46,152,912 V62A probably benign Het
Map1b T C 13: 99,430,493 R1907G unknown Het
Mertk A G 2: 128,750,174 I273V probably benign Het
Mfsd4b1 A G 10: 40,003,227 Y225H probably damaging Het
Mrc2 T C 11: 105,338,793 V684A probably damaging Het
Msh6 G A 17: 87,980,223 W97* probably null Het
Mtmr10 A G 7: 64,336,721 I516V possibly damaging Het
Myo7a A T 7: 98,112,606 probably benign Het
Ndufs5 T C 4: 123,712,868 Y92C probably benign Het
Nlrp1b C T 11: 71,160,153 V1035I probably benign Het
Ntrk2 A G 13: 58,861,318 R308G possibly damaging Het
Olfr1148 A G 2: 87,833,299 I87V probably benign Het
Pcdhb16 G T 18: 37,479,180 G398W probably damaging Het
Plpbp T A 8: 27,053,298 S237T probably damaging Het
Pnpla6 T A 8: 3,534,634 F769I possibly damaging Het
Polk A G 13: 96,495,442 V261A probably damaging Het
Prss52 C T 14: 64,113,633 A289V probably damaging Het
Puf60 T C 15: 76,070,874 K407E probably benign Het
Pzp T C 6: 128,485,617 D1455G probably damaging Het
Ranbp17 T C 11: 33,217,301 N1054S probably benign Het
Sdk2 A G 11: 113,793,741 S1965P probably benign Het
Spryd7 T C 14: 61,540,205 Y142C probably damaging Het
Srrt A T 5: 137,299,860 probably benign Het
Stk10 A G 11: 32,622,464 E935G possibly damaging Het
Tas2r115 G A 6: 132,737,971 R6C probably damaging Het
Tdrd7 T A 4: 45,987,681 probably benign Het
Trim29 A T 9: 43,332,376 Q564L probably damaging Het
Trim5 T C 7: 104,276,661 D231G probably damaging Het
Trpv2 A G 11: 62,596,961 K676E probably benign Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a2 A G 1: 88,201,438 I268V probably benign Het
Ugt8a T C 3: 125,874,203 N330D probably benign Het
Utrn G A 10: 12,475,296 H2822Y probably damaging Het
Vmn1r176 G A 7: 23,835,521 A69V probably benign Het
Vmn2r106 T C 17: 20,268,298 Y613C probably damaging Het
Wdfy1 A T 1: 79,709,140 W296R probably damaging Het
Zfp11 G A 5: 129,657,758 T213I possibly damaging Het
Zfp142 A T 1: 74,579,631 F193I probably damaging Het
Zfp764 G A 7: 127,405,567 Q131* probably null Het
Other mutations in Cstf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Cstf1 APN 2 172373073 missense probably benign 0.32
IGL02306:Cstf1 APN 2 172372971 missense probably benign 0.02
IGL02553:Cstf1 APN 2 172377854 missense probably benign 0.19
IGL02756:Cstf1 APN 2 172375875 missense probably damaging 1.00
R0066:Cstf1 UTSW 2 172373056 missense probably benign 0.04
R0066:Cstf1 UTSW 2 172373056 missense probably benign 0.04
R0244:Cstf1 UTSW 2 172377710 missense possibly damaging 0.87
R1448:Cstf1 UTSW 2 172375875 missense probably damaging 1.00
R2055:Cstf1 UTSW 2 172380483 missense probably benign 0.00
R2146:Cstf1 UTSW 2 172375763 missense probably damaging 1.00
R3119:Cstf1 UTSW 2 172373070 missense possibly damaging 0.75
R3701:Cstf1 UTSW 2 172380392 missense probably benign 0.00
R4816:Cstf1 UTSW 2 172372985 missense probably damaging 1.00
R4893:Cstf1 UTSW 2 172380524 missense probably damaging 1.00
R4991:Cstf1 UTSW 2 172377800 missense probably damaging 1.00
R4992:Cstf1 UTSW 2 172377800 missense probably damaging 1.00
R5743:Cstf1 UTSW 2 172377833 missense probably damaging 1.00
R6386:Cstf1 UTSW 2 172377896 missense probably damaging 0.97
R7314:Cstf1 UTSW 2 172373034 missense probably damaging 1.00
R7843:Cstf1 UTSW 2 172378000 missense probably damaging 1.00
R7926:Cstf1 UTSW 2 172378000 missense probably damaging 1.00
X0026:Cstf1 UTSW 2 172375860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCTGGTTTCTCTTGCAGC -3'
(R):5'- TGGTCTACCTGGTGAGTATGGAACG -3'

Sequencing Primer
(F):5'- CGGTCAGGGAAACTGTCATACTC -3'
(R):5'- TATGAGAAGCAGCTTCGTCC -3'
Posted On2014-05-23