Incidental Mutation 'R1770:Ugt8a'
ID196471
Institutional Source Beutler Lab
Gene Symbol Ugt8a
Ensembl Gene ENSMUSG00000032854
Gene NameUDP galactosyltransferase 8A
SynonymsmCerGT, Cgt, Ugt8
MMRRC Submission 039801-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R1770 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location125865271-125938619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125874203 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 330 (N330D)
Ref Sequence ENSEMBL: ENSMUSP00000143605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057944] [ENSMUST00000198610]
Predicted Effect probably benign
Transcript: ENSMUST00000057944
AA Change: N330D

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050852
Gene: ENSMUSG00000032854
AA Change: N330D

DomainStartEndE-ValueType
Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198610
AA Change: N330D

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143605
Gene: ENSMUSG00000032854
AA Change: N330D

DomainStartEndE-ValueType
Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Meta Mutation Damage Score 0.1039 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UDP-glycosyltransferase family. It catalyzes the transfer of galactose to ceramide, a key enzymatic step in the biosynthesis of galactocerebrosides, which are abundant sphingolipids of the myelin membrane of the central and peripheral nervous systems. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutants fail to make galactolipid galactocerebroside and its sulfated derivative that are normal myelin constituents. Mutants have tremors, ataxia, progressive hindlimb paralysis and vacuole formation in ventral spinal cord due to abnormal myelin sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,418,021 T230S probably benign Het
Abcd4 T C 12: 84,615,100 T84A probably benign Het
Adgra1 T A 7: 139,874,031 Y161* probably null Het
Aldoart1 G T 4: 72,851,936 H212N probably benign Het
Aldob A G 4: 49,536,861 Y343H probably damaging Het
Ankrd17 A T 5: 90,243,376 V2036E possibly damaging Het
Ass1 A G 2: 31,486,516 T131A probably benign Het
Baz1a C T 12: 54,898,508 R1354H probably damaging Het
C2cd2l A G 9: 44,316,811 V71A probably benign Het
C4b T A 17: 34,736,927 N678I possibly damaging Het
Carmil1 A G 13: 24,173,674 L64P probably damaging Het
Cdh18 T C 15: 23,474,401 S786P probably benign Het
Cep135 A G 5: 76,603,195 E296G possibly damaging Het
Chml G A 1: 175,687,878 T159I probably benign Het
Cntn3 C T 6: 102,269,205 E328K possibly damaging Het
Cstf1 A G 2: 172,373,063 I35V possibly damaging Het
Cyp2c65 A G 19: 39,082,198 K275R probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbx2 T C 15: 95,624,734 E364G probably benign Het
Dcaf13 A T 15: 39,130,238 N242I probably damaging Het
Dcc A G 18: 71,446,399 V701A probably benign Het
Fastkd5 A T 2: 130,614,280 Y797N probably damaging Het
Fat4 T A 3: 39,010,268 I4791K probably damaging Het
Gm3852 T C 1: 46,011,888 I45V possibly damaging Het
Gng4 A G 13: 13,825,266 D40G probably damaging Het
Gns A G 10: 121,378,047 D209G probably benign Het
Kif6 C A 17: 49,903,649 Q791K possibly damaging Het
Klhl35 G A 7: 99,473,875 V569M possibly damaging Het
Krt2 A G 15: 101,811,154 S694P unknown Het
Lrrc8c A G 5: 105,606,737 Y126C probably damaging Het
Mad2l1bp A G 17: 46,152,912 V62A probably benign Het
Map1b T C 13: 99,430,493 R1907G unknown Het
Mertk A G 2: 128,750,174 I273V probably benign Het
Mfsd4b1 A G 10: 40,003,227 Y225H probably damaging Het
Mrc2 T C 11: 105,338,793 V684A probably damaging Het
Msh6 G A 17: 87,980,223 W97* probably null Het
Mtmr10 A G 7: 64,336,721 I516V possibly damaging Het
Myo7a A T 7: 98,112,606 probably benign Het
Ndufs5 T C 4: 123,712,868 Y92C probably benign Het
Nlrp1b C T 11: 71,160,153 V1035I probably benign Het
Ntrk2 A G 13: 58,861,318 R308G possibly damaging Het
Olfr1148 A G 2: 87,833,299 I87V probably benign Het
Pcdhb16 G T 18: 37,479,180 G398W probably damaging Het
Plpbp T A 8: 27,053,298 S237T probably damaging Het
Pnpla6 T A 8: 3,534,634 F769I possibly damaging Het
Polk A G 13: 96,495,442 V261A probably damaging Het
Prss52 C T 14: 64,113,633 A289V probably damaging Het
Puf60 T C 15: 76,070,874 K407E probably benign Het
Pzp T C 6: 128,485,617 D1455G probably damaging Het
Ranbp17 T C 11: 33,217,301 N1054S probably benign Het
Sdk2 A G 11: 113,793,741 S1965P probably benign Het
Spryd7 T C 14: 61,540,205 Y142C probably damaging Het
Srrt A T 5: 137,299,860 probably benign Het
Stk10 A G 11: 32,622,464 E935G possibly damaging Het
Tas2r115 G A 6: 132,737,971 R6C probably damaging Het
Tdrd7 T A 4: 45,987,681 probably benign Het
Trim29 A T 9: 43,332,376 Q564L probably damaging Het
Trim5 T C 7: 104,276,661 D231G probably damaging Het
Trpv2 A G 11: 62,596,961 K676E probably benign Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a2 A G 1: 88,201,438 I268V probably benign Het
Utrn G A 10: 12,475,296 H2822Y probably damaging Het
Vmn1r176 G A 7: 23,835,521 A69V probably benign Het
Vmn2r106 T C 17: 20,268,298 Y613C probably damaging Het
Wdfy1 A T 1: 79,709,140 W296R probably damaging Het
Zfp11 G A 5: 129,657,758 T213I possibly damaging Het
Zfp142 A T 1: 74,579,631 F193I probably damaging Het
Zfp764 G A 7: 127,405,567 Q131* probably null Het
Other mutations in Ugt8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ugt8a APN 3 125914636 critical splice donor site probably null
IGL01934:Ugt8a APN 3 125914775 missense probably benign 0.18
IGL02435:Ugt8a APN 3 125867320 missense probably benign 0.00
IGL03050:Ugt8a UTSW 3 125875490 missense possibly damaging 0.63
R0041:Ugt8a UTSW 3 125915090 missense probably benign 0.00
R0453:Ugt8a UTSW 3 125914957 missense probably benign 0.03
R1314:Ugt8a UTSW 3 125871748 missense probably benign 0.00
R1544:Ugt8a UTSW 3 125915449 missense probably benign 0.06
R1566:Ugt8a UTSW 3 125875558 missense probably damaging 0.96
R2126:Ugt8a UTSW 3 125875546 missense probably damaging 0.98
R2972:Ugt8a UTSW 3 125915308 missense probably benign
R2973:Ugt8a UTSW 3 125915308 missense probably benign
R3547:Ugt8a UTSW 3 125867382 nonsense probably null
R3906:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R3907:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R4032:Ugt8a UTSW 3 125874158 missense probably damaging 1.00
R5235:Ugt8a UTSW 3 125867480 missense probably damaging 1.00
R5890:Ugt8a UTSW 3 125875553 missense probably benign 0.01
R6790:Ugt8a UTSW 3 125871691 missense possibly damaging 0.93
R6937:Ugt8a UTSW 3 125915601 start gained probably benign
R7298:Ugt8a UTSW 3 125915416 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ACTGCTCAGGTCAACAACTTTCTTTTCA -3'
(R):5'- AGCAAATATTCATTTGGGTCCCCACATC -3'

Sequencing Primer
(F):5'- CTGGATCAGTACTCTGAATTTTGAG -3'
(R):5'- TTGGGTCCCCACATCTACAATAATAG -3'
Posted On2014-05-23