Incidental Mutation 'R1770:9330182L06Rik'
ID196477
Institutional Source Beutler Lab
Gene Symbol 9330182L06Rik
Ensembl Gene ENSMUSG00000056004
Gene NameRIKEN cDNA 9330182L06 gene
Synonyms
MMRRC Submission 039801-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1770 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location9266118-9481825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9418021 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 230 (T230S)
Ref Sequence ENSEMBL: ENSMUSP00000120849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069538] [ENSMUST00000115348] [ENSMUST00000134991] [ENSMUST00000152095] [ENSMUST00000154662] [ENSMUST00000155764]
Predicted Effect probably benign
Transcript: ENSMUST00000069538
AA Change: T230S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069165
Gene: ENSMUSG00000056004
AA Change: T230S

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 334 1.12e-7 PROSPERO
internal_repeat_1 343 665 1.12e-7 PROSPERO
transmembrane domain 926 948 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115348
SMART Domains Protein: ENSMUSP00000111005
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134991
AA Change: T230S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121757
Gene: ENSMUSG00000056004
AA Change: T230S

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 334 9.82e-8 PROSPERO
internal_repeat_1 343 665 9.82e-8 PROSPERO
transmembrane domain 926 948 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142202
Predicted Effect probably benign
Transcript: ENSMUST00000152095
SMART Domains Protein: ENSMUSP00000116440
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000154662
SMART Domains Protein: ENSMUSP00000116026
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155764
AA Change: T230S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000120849
Gene: ENSMUSG00000056004
AA Change: T230S

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 180 5.47e-6 PROSPERO
internal_repeat_1 343 476 5.47e-6 PROSPERO
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 92% (69/75)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T C 12: 84,615,100 T84A probably benign Het
Adgra1 T A 7: 139,874,031 Y161* probably null Het
Aldoart1 G T 4: 72,851,936 H212N probably benign Het
Aldob A G 4: 49,536,861 Y343H probably damaging Het
Ankrd17 A T 5: 90,243,376 V2036E possibly damaging Het
Ass1 A G 2: 31,486,516 T131A probably benign Het
Baz1a C T 12: 54,898,508 R1354H probably damaging Het
C2cd2l A G 9: 44,316,811 V71A probably benign Het
C4b T A 17: 34,736,927 N678I possibly damaging Het
Carmil1 A G 13: 24,173,674 L64P probably damaging Het
Cdh18 T C 15: 23,474,401 S786P probably benign Het
Cep135 A G 5: 76,603,195 E296G possibly damaging Het
Chml G A 1: 175,687,878 T159I probably benign Het
Cntn3 C T 6: 102,269,205 E328K possibly damaging Het
Cstf1 A G 2: 172,373,063 I35V possibly damaging Het
Cyp2c65 A G 19: 39,082,198 K275R probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbx2 T C 15: 95,624,734 E364G probably benign Het
Dcaf13 A T 15: 39,130,238 N242I probably damaging Het
Dcc A G 18: 71,446,399 V701A probably benign Het
Fastkd5 A T 2: 130,614,280 Y797N probably damaging Het
Fat4 T A 3: 39,010,268 I4791K probably damaging Het
Gm3852 T C 1: 46,011,888 I45V possibly damaging Het
Gng4 A G 13: 13,825,266 D40G probably damaging Het
Gns A G 10: 121,378,047 D209G probably benign Het
Kif6 C A 17: 49,903,649 Q791K possibly damaging Het
Klhl35 G A 7: 99,473,875 V569M possibly damaging Het
Krt2 A G 15: 101,811,154 S694P unknown Het
Lrrc8c A G 5: 105,606,737 Y126C probably damaging Het
Mad2l1bp A G 17: 46,152,912 V62A probably benign Het
Map1b T C 13: 99,430,493 R1907G unknown Het
Mertk A G 2: 128,750,174 I273V probably benign Het
Mfsd4b1 A G 10: 40,003,227 Y225H probably damaging Het
Mrc2 T C 11: 105,338,793 V684A probably damaging Het
Msh6 G A 17: 87,980,223 W97* probably null Het
Mtmr10 A G 7: 64,336,721 I516V possibly damaging Het
Myo7a A T 7: 98,112,606 probably benign Het
Ndufs5 T C 4: 123,712,868 Y92C probably benign Het
Nlrp1b C T 11: 71,160,153 V1035I probably benign Het
Ntrk2 A G 13: 58,861,318 R308G possibly damaging Het
Olfr1148 A G 2: 87,833,299 I87V probably benign Het
Pcdhb16 G T 18: 37,479,180 G398W probably damaging Het
Plpbp T A 8: 27,053,298 S237T probably damaging Het
Pnpla6 T A 8: 3,534,634 F769I possibly damaging Het
Polk A G 13: 96,495,442 V261A probably damaging Het
Prss52 C T 14: 64,113,633 A289V probably damaging Het
Puf60 T C 15: 76,070,874 K407E probably benign Het
Pzp T C 6: 128,485,617 D1455G probably damaging Het
Ranbp17 T C 11: 33,217,301 N1054S probably benign Het
Sdk2 A G 11: 113,793,741 S1965P probably benign Het
Spryd7 T C 14: 61,540,205 Y142C probably damaging Het
Srrt A T 5: 137,299,860 probably benign Het
Stk10 A G 11: 32,622,464 E935G possibly damaging Het
Tas2r115 G A 6: 132,737,971 R6C probably damaging Het
Tdrd7 T A 4: 45,987,681 probably benign Het
Trim29 A T 9: 43,332,376 Q564L probably damaging Het
Trim5 T C 7: 104,276,661 D231G probably damaging Het
Trpv2 A G 11: 62,596,961 K676E probably benign Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a2 A G 1: 88,201,438 I268V probably benign Het
Ugt8a T C 3: 125,874,203 N330D probably benign Het
Utrn G A 10: 12,475,296 H2822Y probably damaging Het
Vmn1r176 G A 7: 23,835,521 A69V probably benign Het
Vmn2r106 T C 17: 20,268,298 Y613C probably damaging Het
Wdfy1 A T 1: 79,709,140 W296R probably damaging Het
Zfp11 G A 5: 129,657,758 T213I possibly damaging Het
Zfp142 A T 1: 74,579,631 F193I probably damaging Het
Zfp764 G A 7: 127,405,567 Q131* probably null Het
Other mutations in 9330182L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:9330182L06Rik APN 5 9422367 missense probably damaging 0.99
IGL00909:9330182L06Rik APN 5 9380282 missense probably damaging 1.00
IGL01477:9330182L06Rik APN 5 9437756 missense probably damaging 1.00
IGL02486:9330182L06Rik APN 5 9422323 missense probably benign 0.00
IGL02863:9330182L06Rik APN 5 9461399 nonsense probably null
IGL02939:9330182L06Rik APN 5 9461478 missense probably damaging 1.00
IGL03039:9330182L06Rik APN 5 9418055 missense probably benign 0.12
IGL03395:9330182L06Rik APN 5 9422359 missense probably damaging 0.97
R0063:9330182L06Rik UTSW 5 9440709 intron probably benign
R0063:9330182L06Rik UTSW 5 9440709 intron probably benign
R0193:9330182L06Rik UTSW 5 9422359 missense probably damaging 0.97
R0265:9330182L06Rik UTSW 5 9434681 missense probably damaging 1.00
R0398:9330182L06Rik UTSW 5 9445367 missense probably benign 0.00
R0432:9330182L06Rik UTSW 5 9440966 nonsense probably null
R0494:9330182L06Rik UTSW 5 9420723 critical splice donor site probably null
R0736:9330182L06Rik UTSW 5 9441745 missense probably damaging 1.00
R0850:9330182L06Rik UTSW 5 9417993 missense probably damaging 1.00
R1398:9330182L06Rik UTSW 5 9380297 missense probably damaging 1.00
R1709:9330182L06Rik UTSW 5 9440726 nonsense probably null
R1720:9330182L06Rik UTSW 5 9428407 missense probably damaging 1.00
R1782:9330182L06Rik UTSW 5 9421620 missense possibly damaging 0.62
R1803:9330182L06Rik UTSW 5 9427832 missense probably benign 0.05
R1868:9330182L06Rik UTSW 5 9479251 missense probably damaging 1.00
R1870:9330182L06Rik UTSW 5 9418007 missense probably damaging 0.97
R1871:9330182L06Rik UTSW 5 9418007 missense probably damaging 0.97
R1913:9330182L06Rik UTSW 5 9266275 missense probably damaging 0.97
R2054:9330182L06Rik UTSW 5 9463030 missense possibly damaging 0.81
R2170:9330182L06Rik UTSW 5 9479206 missense probably damaging 1.00
R2381:9330182L06Rik UTSW 5 9380342 missense probably damaging 1.00
R2396:9330182L06Rik UTSW 5 9435395 missense possibly damaging 0.92
R4003:9330182L06Rik UTSW 5 9440877 missense probably benign 0.05
R5030:9330182L06Rik UTSW 5 9428502 missense probably damaging 1.00
R5049:9330182L06Rik UTSW 5 9428488 missense probably damaging 1.00
R5069:9330182L06Rik UTSW 5 9440897 missense probably damaging 1.00
R5219:9330182L06Rik UTSW 5 9461486 missense probably damaging 1.00
R5400:9330182L06Rik UTSW 5 9479247 missense probably damaging 1.00
R5555:9330182L06Rik UTSW 5 9422296 splice site probably null
R5593:9330182L06Rik UTSW 5 9266350 missense probably benign 0.07
R5681:9330182L06Rik UTSW 5 9459308 critical splice donor site probably null
R5707:9330182L06Rik UTSW 5 9441698 missense probably damaging 1.00
R5756:9330182L06Rik UTSW 5 9462995 missense probably damaging 0.98
R6087:9330182L06Rik UTSW 5 9399255 missense probably damaging 1.00
R6252:9330182L06Rik UTSW 5 9410693 missense probably damaging 1.00
R7067:9330182L06Rik UTSW 5 9266295 missense possibly damaging 0.81
R7078:9330182L06Rik UTSW 5 9410709 missense probably benign 0.10
R7079:9330182L06Rik UTSW 5 9399253 missense probably damaging 1.00
R7117:9330182L06Rik UTSW 5 9445384 nonsense probably null
R7265:9330182L06Rik UTSW 5 9446975 missense possibly damaging 0.65
R7996:9330182L06Rik UTSW 5 9462881 missense probably damaging 1.00
X0019:9330182L06Rik UTSW 5 9399231 missense probably damaging 0.97
X0052:9330182L06Rik UTSW 5 9440908 missense possibly damaging 0.87
X0063:9330182L06Rik UTSW 5 9399239 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCAGAACCACTTCCTCACATGCAG -3'
(R):5'- GAACCGCAAAGGCAGTTTCTTCAC -3'

Sequencing Primer
(F):5'- GCAGTTGTAGTGTCGTCTTCAG -3'
(R):5'- GCAAAGGCAGTTTCTTCACTAAATG -3'
Posted On2014-05-23