Incidental Mutation 'R0080:Grk6'
ID19649
Institutional Source Beutler Lab
Gene Symbol Grk6
Ensembl Gene ENSMUSG00000074886
Gene NameG protein-coupled receptor kinase 6
SynonymsGprk6
MMRRC Submission 038367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0080 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55445072-55460927 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55458910 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 474 (S474P)
Ref Sequence ENSEMBL: ENSMUSP00000153668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001115] [ENSMUST00000099482] [ENSMUST00000224118] [ENSMUST00000224653] [ENSMUST00000224995] [ENSMUST00000225925]
Predicted Effect probably benign
Transcript: ENSMUST00000001115
AA Change: S508P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001115
Gene: ENSMUSG00000074886
AA Change: S508P

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
RGS 52 171 1.81e-34 SMART
S_TKc 186 448 8.4e-90 SMART
S_TK_X 449 528 2.8e-8 SMART
low complexity region 572 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099482
AA Change: S508P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097081
Gene: ENSMUSG00000074886
AA Change: S508P

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
RGS 52 171 1.81e-34 SMART
S_TKc 186 448 8.4e-90 SMART
S_TK_X 449 528 2.8e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224118
AA Change: S508P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224532
Predicted Effect probably benign
Transcript: ENSMUST00000224653
AA Change: S476P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000224995
AA Change: S503P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225925
AA Change: S474P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 93.1%
  • 20x: 79.7%
Validation Efficiency 88% (175/200)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Whereas, homozygous mutant mice are viable and show no gross anatomical or behavioral abnormalites under normal physiological conditions, they exhibit locomotor supersensitivity to psychostimulants including cocaine and amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,794,578 probably null Het
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Adgb T C 10: 10,377,839 probably benign Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Coro7 A T 16: 4,630,464 L714Q probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Dsg1b T G 18: 20,397,367 S360A probably damaging Het
Ednra T C 8: 77,675,059 I201V probably benign Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Ggt6 A G 11: 72,437,195 T136A possibly damaging Het
Gnb5 A T 9: 75,314,354 E28V possibly damaging Het
Golgb1 T C 16: 36,898,611 L293P probably damaging Het
Gpr179 A G 11: 97,351,469 V183A probably benign Het
Hectd4 A G 5: 121,349,372 S3477G probably benign Het
Irx3 T C 8: 91,800,326 D250G possibly damaging Het
Jsrp1 T G 10: 80,810,515 M70L probably benign Het
Kcmf1 G T 6: 72,850,487 probably null Het
Med23 T C 10: 24,912,817 V1368A probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nos1 G T 5: 117,893,878 C297F probably damaging Het
Oas1d G A 5: 120,916,892 A176T possibly damaging Het
Odf2l A T 3: 145,124,323 I19F possibly damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pfkfb2 A T 1: 130,714,542 S5R probably benign Het
Pign G T 1: 105,552,405 A848E probably damaging Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ryr2 T A 13: 11,568,475 K4764N probably damaging Het
Scgb1b19 A G 7: 33,287,642 T73A probably damaging Het
Slc35d3 T C 10: 19,849,198 E304G probably damaging Het
Snta1 A G 2: 154,383,837 V209A probably benign Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tigd4 A G 3: 84,594,145 H123R probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trim60 C T 8: 65,000,599 A333T probably damaging Het
Vmn2r82 A T 10: 79,396,505 R779S probably benign Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in Grk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Grk6 APN 13 55451391 missense possibly damaging 0.92
IGL02054:Grk6 APN 13 55454397 missense probably benign 0.03
IGL02156:Grk6 APN 13 55449361 missense possibly damaging 0.86
IGL02442:Grk6 APN 13 55458937 splice site probably benign
IGL02750:Grk6 APN 13 55451543 missense probably damaging 1.00
IGL03340:Grk6 APN 13 55453190 missense probably damaging 1.00
Damper UTSW 13 55458920 missense probably damaging 1.00
Piano UTSW 13 55454527 critical splice donor site probably null
R1077:Grk6 UTSW 13 55454527 critical splice donor site probably null
R1530:Grk6 UTSW 13 55458799 missense probably damaging 0.99
R1531:Grk6 UTSW 13 55452154 missense probably damaging 1.00
R1733:Grk6 UTSW 13 55453166 splice site probably benign
R1851:Grk6 UTSW 13 55451778 nonsense probably null
R1874:Grk6 UTSW 13 55450273 missense probably damaging 1.00
R2142:Grk6 UTSW 13 55454364 missense probably damaging 1.00
R2875:Grk6 UTSW 13 55452304 missense probably damaging 1.00
R5187:Grk6 UTSW 13 55451706 missense probably damaging 1.00
R7010:Grk6 UTSW 13 55450300 missense possibly damaging 0.74
R7104:Grk6 UTSW 13 55454406 missense probably benign 0.36
R7111:Grk6 UTSW 13 55458920 missense probably damaging 1.00
R7769:Grk6 UTSW 13 55451007 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCACCATGCTGATCTCTCCAAATC -3'
(R):5'- AGGGCAGACACTGCTAGGACTTAC -3'

Sequencing Primer
(F):5'- GCTGATCTCTCCAAATCAGGATG -3'
(R):5'- GACTGAAGAGTCTCTGTAGCAATCC -3'
Posted On2013-04-11