Incidental Mutation 'R1770:Mrc2'
ID196505
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
MMRRC Submission 039801-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1770 (G1)
Quality Score119
Status Validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105338793 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 684 (V684A)
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect probably damaging
Transcript: ENSMUST00000021038
AA Change: V684A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: V684A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100335
AA Change: V684A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: V684A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151135
Meta Mutation Damage Score 0.2190 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,418,021 T230S probably benign Het
Abcd4 T C 12: 84,615,100 T84A probably benign Het
Adgra1 T A 7: 139,874,031 Y161* probably null Het
Aldoart1 G T 4: 72,851,936 H212N probably benign Het
Aldob A G 4: 49,536,861 Y343H probably damaging Het
Ankrd17 A T 5: 90,243,376 V2036E possibly damaging Het
Ass1 A G 2: 31,486,516 T131A probably benign Het
Baz1a C T 12: 54,898,508 R1354H probably damaging Het
C2cd2l A G 9: 44,316,811 V71A probably benign Het
C4b T A 17: 34,736,927 N678I possibly damaging Het
Carmil1 A G 13: 24,173,674 L64P probably damaging Het
Cdh18 T C 15: 23,474,401 S786P probably benign Het
Cep135 A G 5: 76,603,195 E296G possibly damaging Het
Chml G A 1: 175,687,878 T159I probably benign Het
Cntn3 C T 6: 102,269,205 E328K possibly damaging Het
Cstf1 A G 2: 172,373,063 I35V possibly damaging Het
Cyp2c65 A G 19: 39,082,198 K275R probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbx2 T C 15: 95,624,734 E364G probably benign Het
Dcaf13 A T 15: 39,130,238 N242I probably damaging Het
Dcc A G 18: 71,446,399 V701A probably benign Het
Fastkd5 A T 2: 130,614,280 Y797N probably damaging Het
Fat4 T A 3: 39,010,268 I4791K probably damaging Het
Gm3852 T C 1: 46,011,888 I45V possibly damaging Het
Gng4 A G 13: 13,825,266 D40G probably damaging Het
Gns A G 10: 121,378,047 D209G probably benign Het
Kif6 C A 17: 49,903,649 Q791K possibly damaging Het
Klhl35 G A 7: 99,473,875 V569M possibly damaging Het
Krt2 A G 15: 101,811,154 S694P unknown Het
Lrrc8c A G 5: 105,606,737 Y126C probably damaging Het
Mad2l1bp A G 17: 46,152,912 V62A probably benign Het
Map1b T C 13: 99,430,493 R1907G unknown Het
Mertk A G 2: 128,750,174 I273V probably benign Het
Mfsd4b1 A G 10: 40,003,227 Y225H probably damaging Het
Msh6 G A 17: 87,980,223 W97* probably null Het
Mtmr10 A G 7: 64,336,721 I516V possibly damaging Het
Myo7a A T 7: 98,112,606 probably benign Het
Ndufs5 T C 4: 123,712,868 Y92C probably benign Het
Nlrp1b C T 11: 71,160,153 V1035I probably benign Het
Ntrk2 A G 13: 58,861,318 R308G possibly damaging Het
Olfr1148 A G 2: 87,833,299 I87V probably benign Het
Pcdhb16 G T 18: 37,479,180 G398W probably damaging Het
Plpbp T A 8: 27,053,298 S237T probably damaging Het
Pnpla6 T A 8: 3,534,634 F769I possibly damaging Het
Polk A G 13: 96,495,442 V261A probably damaging Het
Prss52 C T 14: 64,113,633 A289V probably damaging Het
Puf60 T C 15: 76,070,874 K407E probably benign Het
Pzp T C 6: 128,485,617 D1455G probably damaging Het
Ranbp17 T C 11: 33,217,301 N1054S probably benign Het
Sdk2 A G 11: 113,793,741 S1965P probably benign Het
Spryd7 T C 14: 61,540,205 Y142C probably damaging Het
Srrt A T 5: 137,299,860 probably benign Het
Stk10 A G 11: 32,622,464 E935G possibly damaging Het
Tas2r115 G A 6: 132,737,971 R6C probably damaging Het
Tdrd7 T A 4: 45,987,681 probably benign Het
Trim29 A T 9: 43,332,376 Q564L probably damaging Het
Trim5 T C 7: 104,276,661 D231G probably damaging Het
Trpv2 A G 11: 62,596,961 K676E probably benign Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a2 A G 1: 88,201,438 I268V probably benign Het
Ugt8a T C 3: 125,874,203 N330D probably benign Het
Utrn G A 10: 12,475,296 H2822Y probably damaging Het
Vmn1r176 G A 7: 23,835,521 A69V probably benign Het
Vmn2r106 T C 17: 20,268,298 Y613C probably damaging Het
Wdfy1 A T 1: 79,709,140 W296R probably damaging Het
Zfp11 G A 5: 129,657,758 T213I possibly damaging Het
Zfp142 A T 1: 74,579,631 F193I probably damaging Het
Zfp764 G A 7: 127,405,567 Q131* probably null Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
R7537:Mrc2 UTSW 11 105292797 missense probably benign
R7640:Mrc2 UTSW 11 105332295 missense possibly damaging 0.48
R7709:Mrc2 UTSW 11 105346459 missense probably benign 0.10
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAAGTCCTGTCTTCAGTCAGTTGTGG -3'
(R):5'- TTCTGACCCCAAGCGTGACAGAAC -3'

Sequencing Primer
(F):5'- gttgtggctctgctggg -3'
(R):5'- AGAATCTGGCAGCCATGC -3'
Posted On2014-05-23