Incidental Mutation 'R1770:Baz1a'
ID 196507
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Name bromodomain adjacent to zinc finger domain 1A
Synonyms Gtl5, Wcrf180, Acf1
MMRRC Submission 039801-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1770 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 54939774-55061133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 54945293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1354 (R1354H)
Ref Sequence ENSEMBL: ENSMUSP00000133478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
AlphaFold O88379
Predicted Effect probably damaging
Transcript: ENSMUST00000038926
AA Change: R1357H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: R1357H

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173433
AA Change: R1354H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: R1354H

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173453
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T C 12: 84,661,874 (GRCm39) T84A probably benign Het
Adgra1 T A 7: 139,453,947 (GRCm39) Y161* probably null Het
Aldoart1 G T 4: 72,770,173 (GRCm39) H212N probably benign Het
Aldob A G 4: 49,536,861 (GRCm39) Y343H probably damaging Het
Ankrd17 A T 5: 90,391,235 (GRCm39) V2036E possibly damaging Het
Ass1 A G 2: 31,376,528 (GRCm39) T131A probably benign Het
C2cd2l A G 9: 44,228,108 (GRCm39) V71A probably benign Het
C4b T A 17: 34,955,901 (GRCm39) N678I possibly damaging Het
Carmil1 A G 13: 24,357,657 (GRCm39) L64P probably damaging Het
Cdh18 T C 15: 23,474,487 (GRCm39) S786P probably benign Het
Cep135 A G 5: 76,751,042 (GRCm39) E296G possibly damaging Het
Chml G A 1: 175,515,444 (GRCm39) T159I probably benign Het
Cntn3 C T 6: 102,246,166 (GRCm39) E328K possibly damaging Het
Cstf1 A G 2: 172,214,983 (GRCm39) I35V possibly damaging Het
Cyp2c65 A G 19: 39,070,642 (GRCm39) K275R probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dbx2 T C 15: 95,522,615 (GRCm39) E364G probably benign Het
Dcaf13 A T 15: 38,993,633 (GRCm39) N242I probably damaging Het
Dcc A G 18: 71,579,470 (GRCm39) V701A probably benign Het
Elapor2 A T 5: 9,468,021 (GRCm39) T230S probably benign Het
Fastkd5 A T 2: 130,456,200 (GRCm39) Y797N probably damaging Het
Fat4 T A 3: 39,064,417 (GRCm39) I4791K probably damaging Het
Gm3852 T C 1: 46,051,048 (GRCm39) I45V possibly damaging Het
Gng4 A G 13: 13,999,851 (GRCm39) D40G probably damaging Het
Gns A G 10: 121,213,952 (GRCm39) D209G probably benign Het
Kif6 C A 17: 50,210,677 (GRCm39) Q791K possibly damaging Het
Klhl35 G A 7: 99,123,082 (GRCm39) V569M possibly damaging Het
Krt1c A G 15: 101,719,589 (GRCm39) S694P unknown Het
Lrrc8c A G 5: 105,754,603 (GRCm39) Y126C probably damaging Het
Mad2l1bp A G 17: 46,463,838 (GRCm39) V62A probably benign Het
Map1b T C 13: 99,567,001 (GRCm39) R1907G unknown Het
Mertk A G 2: 128,592,094 (GRCm39) I273V probably benign Het
Mfsd4b1 A G 10: 39,879,223 (GRCm39) Y225H probably damaging Het
Mrc2 T C 11: 105,229,619 (GRCm39) V684A probably damaging Het
Msh6 G A 17: 88,287,651 (GRCm39) W97* probably null Het
Mtmr10 A G 7: 63,986,469 (GRCm39) I516V possibly damaging Het
Myo7a A T 7: 97,761,813 (GRCm39) probably benign Het
Ndufs5 T C 4: 123,606,661 (GRCm39) Y92C probably benign Het
Nlrp1b C T 11: 71,050,979 (GRCm39) V1035I probably benign Het
Ntrk2 A G 13: 59,009,132 (GRCm39) R308G possibly damaging Het
Or12e13 A G 2: 87,663,643 (GRCm39) I87V probably benign Het
Pcdhb16 G T 18: 37,612,233 (GRCm39) G398W probably damaging Het
Plpbp T A 8: 27,543,326 (GRCm39) S237T probably damaging Het
Pnpla6 T A 8: 3,584,634 (GRCm39) F769I possibly damaging Het
Polk A G 13: 96,631,950 (GRCm39) V261A probably damaging Het
Prss52 C T 14: 64,351,082 (GRCm39) A289V probably damaging Het
Puf60 T C 15: 75,942,723 (GRCm39) K407E probably benign Het
Pzp T C 6: 128,462,580 (GRCm39) D1455G probably damaging Het
Ranbp17 T C 11: 33,167,301 (GRCm39) N1054S probably benign Het
Sdk2 A G 11: 113,684,567 (GRCm39) S1965P probably benign Het
Spryd7 T C 14: 61,777,654 (GRCm39) Y142C probably damaging Het
Srrt A T 5: 137,298,122 (GRCm39) probably benign Het
Stk10 A G 11: 32,572,464 (GRCm39) E935G possibly damaging Het
Tas2r115 G A 6: 132,714,934 (GRCm39) R6C probably damaging Het
Tdrd7 T A 4: 45,987,681 (GRCm39) probably benign Het
Trim29 A T 9: 43,243,673 (GRCm39) Q564L probably damaging Het
Trim5 T C 7: 103,925,868 (GRCm39) D231G probably damaging Het
Trpv2 A G 11: 62,487,787 (GRCm39) K676E probably benign Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a2 A G 1: 88,129,160 (GRCm39) I268V probably benign Het
Ugt8a T C 3: 125,667,852 (GRCm39) N330D probably benign Het
Utrn G A 10: 12,351,040 (GRCm39) H2822Y probably damaging Het
Vmn1r176 G A 7: 23,534,946 (GRCm39) A69V probably benign Het
Vmn2r106 T C 17: 20,488,560 (GRCm39) Y613C probably damaging Het
Wdfy1 A T 1: 79,686,857 (GRCm39) W296R probably damaging Het
Zfp11 G A 5: 129,734,822 (GRCm39) T213I possibly damaging Het
Zfp142 A T 1: 74,618,790 (GRCm39) F193I probably damaging Het
Zfp764 G A 7: 127,004,739 (GRCm39) Q131* probably null Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54,963,516 (GRCm39) missense probably benign
IGL01138:Baz1a APN 12 54,977,110 (GRCm39) missense probably damaging 1.00
IGL01298:Baz1a APN 12 55,001,594 (GRCm39) missense probably damaging 1.00
IGL02639:Baz1a APN 12 54,942,810 (GRCm39) splice site probably benign
IGL02995:Baz1a APN 12 54,947,232 (GRCm39) missense probably damaging 1.00
IGL03001:Baz1a APN 12 54,969,896 (GRCm39) missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54,941,743 (GRCm39) missense probably damaging 1.00
IGL03135:Baz1a APN 12 54,976,375 (GRCm39) missense probably damaging 1.00
IGL03151:Baz1a APN 12 54,955,934 (GRCm39) critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54,945,320 (GRCm39) missense probably damaging 1.00
IGL03240:Baz1a APN 12 54,974,352 (GRCm39) nonsense probably null
Bezos UTSW 12 54,941,816 (GRCm39) nonsense probably null
Flavia UTSW 12 55,022,093 (GRCm39) missense probably damaging 1.00
gumdrops UTSW 12 54,947,233 (GRCm39) missense probably damaging 1.00
Kilter UTSW 12 54,947,317 (GRCm39) missense probably damaging 0.99
Kisses UTSW 12 55,021,922 (GRCm39) missense probably damaging 1.00
liverlips UTSW 12 54,967,928 (GRCm39) missense possibly damaging 0.68
smooch UTSW 12 54,963,608 (GRCm39) missense probably damaging 1.00
Smootch UTSW 12 54,958,170 (GRCm39) missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54,977,095 (GRCm39) missense probably benign 0.03
R0127:Baz1a UTSW 12 54,945,491 (GRCm39) missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54,958,172 (GRCm39) missense probably damaging 1.00
R0393:Baz1a UTSW 12 54,965,221 (GRCm39) critical splice donor site probably null
R0532:Baz1a UTSW 12 54,981,605 (GRCm39) missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54,988,304 (GRCm39) nonsense probably null
R0626:Baz1a UTSW 12 55,022,055 (GRCm39) missense probably damaging 0.99
R0654:Baz1a UTSW 12 54,958,182 (GRCm39) missense probably benign 0.01
R0782:Baz1a UTSW 12 54,941,273 (GRCm39) missense probably damaging 1.00
R0826:Baz1a UTSW 12 54,977,097 (GRCm39) nonsense probably null
R0855:Baz1a UTSW 12 54,947,348 (GRCm39) splice site probably benign
R0927:Baz1a UTSW 12 54,941,773 (GRCm39) missense probably damaging 1.00
R0941:Baz1a UTSW 12 54,945,216 (GRCm39) missense probably benign 0.00
R1079:Baz1a UTSW 12 54,941,785 (GRCm39) missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54,976,349 (GRCm39) missense probably damaging 1.00
R1647:Baz1a UTSW 12 55,021,983 (GRCm39) missense probably damaging 1.00
R1731:Baz1a UTSW 12 54,965,330 (GRCm39) missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54,945,573 (GRCm39) nonsense probably null
R1762:Baz1a UTSW 12 54,955,805 (GRCm39) missense probably damaging 1.00
R1968:Baz1a UTSW 12 54,947,122 (GRCm39) missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54,976,431 (GRCm39) missense probably damaging 1.00
R2111:Baz1a UTSW 12 54,958,170 (GRCm39) missense probably damaging 1.00
R2215:Baz1a UTSW 12 55,022,154 (GRCm39) nonsense probably null
R2282:Baz1a UTSW 12 54,963,597 (GRCm39) nonsense probably null
R2875:Baz1a UTSW 12 54,969,904 (GRCm39) missense probably damaging 1.00
R2890:Baz1a UTSW 12 54,945,302 (GRCm39) missense probably benign
R2971:Baz1a UTSW 12 54,970,224 (GRCm39) missense probably damaging 1.00
R3404:Baz1a UTSW 12 54,963,774 (GRCm39) missense probably benign 0.00
R3419:Baz1a UTSW 12 54,993,684 (GRCm39) missense probably benign 0.05
R3699:Baz1a UTSW 12 54,963,831 (GRCm39) missense probably benign 0.09
R3899:Baz1a UTSW 12 54,981,589 (GRCm39) missense probably benign 0.01
R3927:Baz1a UTSW 12 54,967,928 (GRCm39) missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54,976,404 (GRCm39) missense probably benign 0.00
R4072:Baz1a UTSW 12 54,988,345 (GRCm39) missense probably benign 0.18
R4196:Baz1a UTSW 12 54,958,200 (GRCm39) missense probably damaging 1.00
R4289:Baz1a UTSW 12 54,947,233 (GRCm39) missense probably damaging 1.00
R4455:Baz1a UTSW 12 54,958,153 (GRCm39) missense probably benign 0.26
R4583:Baz1a UTSW 12 54,969,325 (GRCm39) missense probably damaging 0.99
R4622:Baz1a UTSW 12 54,988,300 (GRCm39) missense probably benign 0.00
R4807:Baz1a UTSW 12 54,945,267 (GRCm39) missense probably benign 0.28
R4998:Baz1a UTSW 12 55,021,922 (GRCm39) missense probably damaging 1.00
R5239:Baz1a UTSW 12 54,945,129 (GRCm39) missense probably damaging 0.99
R5379:Baz1a UTSW 12 54,941,133 (GRCm39) missense probably damaging 1.00
R5408:Baz1a UTSW 12 54,969,835 (GRCm39) missense probably damaging 1.00
R5678:Baz1a UTSW 12 54,947,317 (GRCm39) missense probably damaging 0.99
R5810:Baz1a UTSW 12 54,974,500 (GRCm39) intron probably benign
R6092:Baz1a UTSW 12 54,955,868 (GRCm39) missense possibly damaging 0.88
R6317:Baz1a UTSW 12 55,001,585 (GRCm39) missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54,965,339 (GRCm39) missense probably benign 0.01
R6803:Baz1a UTSW 12 54,988,340 (GRCm39) missense probably null 0.99
R7185:Baz1a UTSW 12 55,022,093 (GRCm39) missense probably damaging 1.00
R7248:Baz1a UTSW 12 54,947,293 (GRCm39) missense probably damaging 1.00
R7392:Baz1a UTSW 12 54,945,550 (GRCm39) missense probably damaging 1.00
R8009:Baz1a UTSW 12 54,941,816 (GRCm39) nonsense probably null
R8025:Baz1a UTSW 12 54,955,921 (GRCm39) missense probably benign 0.34
R8392:Baz1a UTSW 12 54,969,908 (GRCm39) missense probably damaging 1.00
R8862:Baz1a UTSW 12 55,032,624 (GRCm39) unclassified probably benign
R8949:Baz1a UTSW 12 54,941,238 (GRCm39) missense probably damaging 1.00
R9340:Baz1a UTSW 12 54,963,372 (GRCm39) missense probably damaging 0.97
R9389:Baz1a UTSW 12 54,963,608 (GRCm39) missense probably damaging 1.00
R9401:Baz1a UTSW 12 54,963,339 (GRCm39) missense probably damaging 1.00
R9666:Baz1a UTSW 12 54,988,345 (GRCm39) missense probably benign 0.18
R9722:Baz1a UTSW 12 54,946,882 (GRCm39) missense probably benign 0.43
R9746:Baz1a UTSW 12 55,021,895 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAATTTAGTACCCTGCCCTGTGCC -3'
(R):5'- GAAGATACCCTTCAAGGAGCCAGC -3'

Sequencing Primer
(F):5'- agtgataaaggcagaggcag -3'
(R):5'- TTCAAGGAGCCAGCAGAGC -3'
Posted On 2014-05-23