Incidental Mutation 'R0080:Golgb1'
ID 19651
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission 038367-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.908) question?
Stock # R0080 (G1)
Quality Score 122
Status Validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36718973 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 293 (L293P)
Ref Sequence ENSEMBL: ENSMUSP00000110460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039855
AA Change: L334P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: L334P

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114812
AA Change: L293P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: L293P

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231790
Meta Mutation Damage Score 0.0873 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 93.1%
  • 20x: 79.7%
Validation Efficiency 88% (175/200)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,630,440 (GRCm39) probably null Het
Adam17 A C 12: 21,379,049 (GRCm39) probably benign Het
Adcy1 T C 11: 7,099,497 (GRCm39) probably benign Het
Adgb T C 10: 10,253,583 (GRCm39) probably benign Het
Antkmt T C 17: 26,010,548 (GRCm39) I89V probably benign Het
Ccdc180 A G 4: 45,896,205 (GRCm39) D118G probably null Het
Coro7 A T 16: 4,448,328 (GRCm39) L714Q probably damaging Het
D2hgdh A G 1: 93,754,177 (GRCm39) Y50C probably damaging Het
Dsg1b T G 18: 20,530,424 (GRCm39) S360A probably damaging Het
Ednra T C 8: 78,401,688 (GRCm39) I201V probably benign Het
Ggt6 A G 11: 72,328,021 (GRCm39) T136A possibly damaging Het
Gnb5 A T 9: 75,221,636 (GRCm39) E28V possibly damaging Het
Gpr179 A G 11: 97,242,295 (GRCm39) V183A probably benign Het
Grk6 T C 13: 55,606,723 (GRCm39) S474P probably benign Het
Hectd4 A G 5: 121,487,435 (GRCm39) S3477G probably benign Het
Hoatz T C 9: 51,013,102 (GRCm39) T57A probably benign Het
Irx3 T C 8: 92,526,954 (GRCm39) D250G possibly damaging Het
Jsrp1 T G 10: 80,646,349 (GRCm39) M70L probably benign Het
Kcmf1 G T 6: 72,827,470 (GRCm39) probably null Het
Med23 T C 10: 24,788,715 (GRCm39) V1368A probably benign Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Ncoa6 TGC TGCGC 2: 155,250,211 (GRCm39) probably null Het
Nos1 G T 5: 118,031,943 (GRCm39) C297F probably damaging Het
Oas1d G A 5: 121,054,955 (GRCm39) A176T possibly damaging Het
Odf2l A T 3: 144,830,084 (GRCm39) I19F possibly damaging Het
Or6c1b T C 10: 129,273,140 (GRCm39) I153T possibly damaging Het
Or6c209 G A 10: 129,483,522 (GRCm39) C175Y probably benign Het
Pfkfb2 A T 1: 130,642,279 (GRCm39) S5R probably benign Het
Pign G T 1: 105,480,130 (GRCm39) A848E probably damaging Het
Pomgnt2 A T 9: 121,811,326 (GRCm39) V485E probably damaging Het
Ryr2 T A 13: 11,583,361 (GRCm39) K4764N probably damaging Het
Scgb1b19 A G 7: 32,987,067 (GRCm39) T73A probably damaging Het
Slc35d3 T C 10: 19,724,944 (GRCm39) E304G probably damaging Het
Snta1 A G 2: 154,225,757 (GRCm39) V209A probably benign Het
Spdye4b A T 5: 143,181,430 (GRCm39) D95V probably damaging Het
Srek1 T C 13: 103,880,194 (GRCm39) T455A unknown Het
Tie1 T A 4: 118,341,550 (GRCm39) E254V probably damaging Het
Tigd4 A G 3: 84,501,452 (GRCm39) H123R probably benign Het
Tmem144 G A 3: 79,746,580 (GRCm39) probably benign Het
Trim60 C T 8: 65,453,251 (GRCm39) A333T probably damaging Het
Vmn2r82 A T 10: 79,232,339 (GRCm39) R779S probably benign Het
Wdr91 T C 6: 34,883,620 (GRCm39) R132G possibly damaging Het
Zfp445 A G 9: 122,681,421 (GRCm39) V840A probably damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0102:Golgb1 UTSW 16 36,695,830 (GRCm39) intron probably benign
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36,707,980 (GRCm39) missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36,736,480 (GRCm39) missense probably benign 0.05
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5185:Golgb1 UTSW 16 36,695,503 (GRCm39) unclassified probably benign
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7789:Golgb1 UTSW 16 36,695,761 (GRCm39) missense unknown
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36,752,282 (GRCm39) missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8940:Golgb1 UTSW 16 36,736,759 (GRCm39) missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36,739,967 (GRCm39) missense probably benign 0.41
R9620:Golgb1 UTSW 16 36,739,811 (GRCm39) missense probably benign
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36,713,769 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCCACAGGTTCAGTGCCAGTG -3'
(R):5'- ACTCAAAATGCAAGCCGTCTTCTCC -3'

Sequencing Primer
(F):5'- TCAGTGTGCTCCCCGAATG -3'
(R):5'- AAGCCGTCTTCTCCTCCATC -3'
Posted On 2013-04-11