Incidental Mutation 'R1770:Polk'
ID196512
Institutional Source Beutler Lab
Gene Symbol Polk
Ensembl Gene ENSMUSG00000021668
Gene Namepolymerase (DNA directed), kappa
SynonymsDinb1
MMRRC Submission 039801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1770 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location96480690-96542579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96495442 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 261 (V261A)
Ref Sequence ENSEMBL: ENSMUSP00000152192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000091387] [ENSMUST00000165358] [ENSMUST00000220977] [ENSMUST00000221645] [ENSMUST00000221899] [ENSMUST00000222075] [ENSMUST00000222143] [ENSMUST00000222389]
Predicted Effect probably damaging
Transcript: ENSMUST00000022172
AA Change: V341A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668
AA Change: V341A

DomainStartEndE-ValueType
Pfam:IMS 105 324 1.7e-47 PFAM
Pfam:IMS_C 406 525 5.5e-22 PFAM
PDB:2LSJ|B 559 582 9e-8 PDB
ZnF_Rad18 619 645 2.89e-9 SMART
ZnF_Rad18 761 787 2.31e-8 SMART
low complexity region 828 839 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091387
AA Change: V282A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088950
Gene: ENSMUSG00000021668
AA Change: V282A

DomainStartEndE-ValueType
Pfam:IMS 105 265 1.1e-37 PFAM
Pfam:IMS_C 346 469 8.8e-19 PFAM
PDB:2LSJ|B 500 523 9e-8 PDB
ZnF_Rad18 560 586 2.89e-9 SMART
ZnF_Rad18 702 728 2.31e-8 SMART
low complexity region 769 780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165358
Predicted Effect probably damaging
Transcript: ENSMUST00000220977
AA Change: V261A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000221645
AA Change: V341A

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000221899
AA Change: V261A

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000222075
Predicted Effect probably benign
Transcript: ENSMUST00000222143
AA Change: V261A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably damaging
Transcript: ENSMUST00000222389
AA Change: V261A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6800 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA polymerase type-Y family of proteins. The encoded protein is a specialized DNA polymerase that catalyzes translesion DNA synthesis, which allows DNA replication in the presence of DNA lesions. Human cell lines lacking a functional copy of this gene exhibit impaired genome integrity and enhanced susceptibility to oxidative damage. Mutations in this gene that impair enzyme activity may be associated with prostate cancer in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene that results in a truncated transcript results in a higher rate of spontaneous germline expanded simple tandem repeat mutations. Homozyogus null mice exhibit normal immunoglobulin gene somatic hypermutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,418,021 T230S probably benign Het
Abcd4 T C 12: 84,615,100 T84A probably benign Het
Adgra1 T A 7: 139,874,031 Y161* probably null Het
Aldoart1 G T 4: 72,851,936 H212N probably benign Het
Aldob A G 4: 49,536,861 Y343H probably damaging Het
Ankrd17 A T 5: 90,243,376 V2036E possibly damaging Het
Ass1 A G 2: 31,486,516 T131A probably benign Het
Baz1a C T 12: 54,898,508 R1354H probably damaging Het
C2cd2l A G 9: 44,316,811 V71A probably benign Het
C4b T A 17: 34,736,927 N678I possibly damaging Het
Carmil1 A G 13: 24,173,674 L64P probably damaging Het
Cdh18 T C 15: 23,474,401 S786P probably benign Het
Cep135 A G 5: 76,603,195 E296G possibly damaging Het
Chml G A 1: 175,687,878 T159I probably benign Het
Cntn3 C T 6: 102,269,205 E328K possibly damaging Het
Cstf1 A G 2: 172,373,063 I35V possibly damaging Het
Cyp2c65 A G 19: 39,082,198 K275R probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbx2 T C 15: 95,624,734 E364G probably benign Het
Dcaf13 A T 15: 39,130,238 N242I probably damaging Het
Dcc A G 18: 71,446,399 V701A probably benign Het
Fastkd5 A T 2: 130,614,280 Y797N probably damaging Het
Fat4 T A 3: 39,010,268 I4791K probably damaging Het
Gm3852 T C 1: 46,011,888 I45V possibly damaging Het
Gng4 A G 13: 13,825,266 D40G probably damaging Het
Gns A G 10: 121,378,047 D209G probably benign Het
Kif6 C A 17: 49,903,649 Q791K possibly damaging Het
Klhl35 G A 7: 99,473,875 V569M possibly damaging Het
Krt2 A G 15: 101,811,154 S694P unknown Het
Lrrc8c A G 5: 105,606,737 Y126C probably damaging Het
Mad2l1bp A G 17: 46,152,912 V62A probably benign Het
Map1b T C 13: 99,430,493 R1907G unknown Het
Mertk A G 2: 128,750,174 I273V probably benign Het
Mfsd4b1 A G 10: 40,003,227 Y225H probably damaging Het
Mrc2 T C 11: 105,338,793 V684A probably damaging Het
Msh6 G A 17: 87,980,223 W97* probably null Het
Mtmr10 A G 7: 64,336,721 I516V possibly damaging Het
Myo7a A T 7: 98,112,606 probably benign Het
Ndufs5 T C 4: 123,712,868 Y92C probably benign Het
Nlrp1b C T 11: 71,160,153 V1035I probably benign Het
Ntrk2 A G 13: 58,861,318 R308G possibly damaging Het
Olfr1148 A G 2: 87,833,299 I87V probably benign Het
Pcdhb16 G T 18: 37,479,180 G398W probably damaging Het
Plpbp T A 8: 27,053,298 S237T probably damaging Het
Pnpla6 T A 8: 3,534,634 F769I possibly damaging Het
Prss52 C T 14: 64,113,633 A289V probably damaging Het
Puf60 T C 15: 76,070,874 K407E probably benign Het
Pzp T C 6: 128,485,617 D1455G probably damaging Het
Ranbp17 T C 11: 33,217,301 N1054S probably benign Het
Sdk2 A G 11: 113,793,741 S1965P probably benign Het
Spryd7 T C 14: 61,540,205 Y142C probably damaging Het
Srrt A T 5: 137,299,860 probably benign Het
Stk10 A G 11: 32,622,464 E935G possibly damaging Het
Tas2r115 G A 6: 132,737,971 R6C probably damaging Het
Tdrd7 T A 4: 45,987,681 probably benign Het
Trim29 A T 9: 43,332,376 Q564L probably damaging Het
Trim5 T C 7: 104,276,661 D231G probably damaging Het
Trpv2 A G 11: 62,596,961 K676E probably benign Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a2 A G 1: 88,201,438 I268V probably benign Het
Ugt8a T C 3: 125,874,203 N330D probably benign Het
Utrn G A 10: 12,475,296 H2822Y probably damaging Het
Vmn1r176 G A 7: 23,835,521 A69V probably benign Het
Vmn2r106 T C 17: 20,268,298 Y613C probably damaging Het
Wdfy1 A T 1: 79,709,140 W296R probably damaging Het
Zfp11 G A 5: 129,657,758 T213I possibly damaging Het
Zfp142 A T 1: 74,579,631 F193I probably damaging Het
Zfp764 G A 7: 127,405,567 Q131* probably null Het
Other mutations in Polk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Polk APN 13 96496760 missense probably benign 0.25
IGL01803:Polk APN 13 96504522 missense probably damaging 1.00
IGL01949:Polk APN 13 96483538 missense probably benign 0.10
IGL01986:Polk APN 13 96483823 missense probably benign 0.09
IGL02073:Polk APN 13 96504551 missense probably damaging 1.00
IGL03165:Polk APN 13 96516688 missense probably benign 0.23
IGL03184:Polk APN 13 96483983 missense probably benign 0.04
IGL03353:Polk APN 13 96489211 missense probably damaging 1.00
R0019:Polk UTSW 13 96504616 missense probably damaging 1.00
R0029:Polk UTSW 13 96516670 missense probably damaging 1.00
R0200:Polk UTSW 13 96496822 missense probably benign 0.11
R0357:Polk UTSW 13 96504597 missense probably damaging 0.99
R0485:Polk UTSW 13 96483764 missense probably benign 0.05
R0555:Polk UTSW 13 96484179 missense probably damaging 0.97
R0687:Polk UTSW 13 96484017 missense probably damaging 1.00
R0980:Polk UTSW 13 96483764 missense probably benign 0.05
R1065:Polk UTSW 13 96508252 missense probably damaging 1.00
R1396:Polk UTSW 13 96484208 missense probably benign 0.02
R1710:Polk UTSW 13 96489204 missense probably damaging 1.00
R1789:Polk UTSW 13 96496632 missense probably damaging 1.00
R1977:Polk UTSW 13 96489228 missense probably damaging 1.00
R2301:Polk UTSW 13 96484144 missense probably benign 0.09
R3797:Polk UTSW 13 96486982 splice site probably benign
R3934:Polk UTSW 13 96501635 missense possibly damaging 0.56
R4082:Polk UTSW 13 96483673 missense probably benign 0.17
R4307:Polk UTSW 13 96496666 missense possibly damaging 0.79
R4472:Polk UTSW 13 96493905 missense probably damaging 1.00
R4779:Polk UTSW 13 96496491 critical splice donor site probably null
R4795:Polk UTSW 13 96489256 missense probably benign 0.01
R4796:Polk UTSW 13 96489256 missense probably benign 0.01
R4810:Polk UTSW 13 96483495 missense possibly damaging 0.90
R5002:Polk UTSW 13 96489244 missense probably damaging 1.00
R5271:Polk UTSW 13 96483539 missense probably benign 0.09
R5415:Polk UTSW 13 96483955 missense probably benign
R5459:Polk UTSW 13 96495476 missense probably damaging 1.00
R5535:Polk UTSW 13 96495497 missense probably damaging 1.00
R5619:Polk UTSW 13 96483556 missense probably damaging 1.00
R5757:Polk UTSW 13 96484252 missense probably benign 0.03
R5801:Polk UTSW 13 96483586 missense probably damaging 1.00
R5923:Polk UTSW 13 96495415 missense probably damaging 1.00
R6365:Polk UTSW 13 96484009 missense probably damaging 1.00
R6670:Polk UTSW 13 96496630 nonsense probably null
R6831:Polk UTSW 13 96495491 missense possibly damaging 0.87
R6932:Polk UTSW 13 96516681 missense probably damaging 1.00
R7216:Polk UTSW 13 96508220 missense probably benign 0.32
R7654:Polk UTSW 13 96496813
Predicted Primers PCR Primer
(F):5'- ACAGCTCTTCAGCAACGACAGTTAC -3'
(R):5'- CGAGCATTTGCATGTCCTTGTCAC -3'

Sequencing Primer
(F):5'- tgaaccccaaacatacgctac -3'
(R):5'- GCATGTCCTTGTCACATAATTAACTC -3'
Posted On2014-05-23