Incidental Mutation 'R1770:C4b'
ID196522
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 039801-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1770 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34736927 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 678 (N678I)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069507
AA Change: N678I

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: N678I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Meta Mutation Damage Score 0.3140 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 92% (69/75)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,418,021 T230S probably benign Het
Abcd4 T C 12: 84,615,100 T84A probably benign Het
Adgra1 T A 7: 139,874,031 Y161* probably null Het
Aldoart1 G T 4: 72,851,936 H212N probably benign Het
Aldob A G 4: 49,536,861 Y343H probably damaging Het
Ankrd17 A T 5: 90,243,376 V2036E possibly damaging Het
Ass1 A G 2: 31,486,516 T131A probably benign Het
Baz1a C T 12: 54,898,508 R1354H probably damaging Het
C2cd2l A G 9: 44,316,811 V71A probably benign Het
Carmil1 A G 13: 24,173,674 L64P probably damaging Het
Cdh18 T C 15: 23,474,401 S786P probably benign Het
Cep135 A G 5: 76,603,195 E296G possibly damaging Het
Chml G A 1: 175,687,878 T159I probably benign Het
Cntn3 C T 6: 102,269,205 E328K possibly damaging Het
Cstf1 A G 2: 172,373,063 I35V possibly damaging Het
Cyp2c65 A G 19: 39,082,198 K275R probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbx2 T C 15: 95,624,734 E364G probably benign Het
Dcaf13 A T 15: 39,130,238 N242I probably damaging Het
Dcc A G 18: 71,446,399 V701A probably benign Het
Fastkd5 A T 2: 130,614,280 Y797N probably damaging Het
Fat4 T A 3: 39,010,268 I4791K probably damaging Het
Gm3852 T C 1: 46,011,888 I45V possibly damaging Het
Gng4 A G 13: 13,825,266 D40G probably damaging Het
Gns A G 10: 121,378,047 D209G probably benign Het
Kif6 C A 17: 49,903,649 Q791K possibly damaging Het
Klhl35 G A 7: 99,473,875 V569M possibly damaging Het
Krt2 A G 15: 101,811,154 S694P unknown Het
Lrrc8c A G 5: 105,606,737 Y126C probably damaging Het
Mad2l1bp A G 17: 46,152,912 V62A probably benign Het
Map1b T C 13: 99,430,493 R1907G unknown Het
Mertk A G 2: 128,750,174 I273V probably benign Het
Mfsd4b1 A G 10: 40,003,227 Y225H probably damaging Het
Mrc2 T C 11: 105,338,793 V684A probably damaging Het
Msh6 G A 17: 87,980,223 W97* probably null Het
Mtmr10 A G 7: 64,336,721 I516V possibly damaging Het
Myo7a A T 7: 98,112,606 probably benign Het
Ndufs5 T C 4: 123,712,868 Y92C probably benign Het
Nlrp1b C T 11: 71,160,153 V1035I probably benign Het
Ntrk2 A G 13: 58,861,318 R308G possibly damaging Het
Olfr1148 A G 2: 87,833,299 I87V probably benign Het
Pcdhb16 G T 18: 37,479,180 G398W probably damaging Het
Plpbp T A 8: 27,053,298 S237T probably damaging Het
Pnpla6 T A 8: 3,534,634 F769I possibly damaging Het
Polk A G 13: 96,495,442 V261A probably damaging Het
Prss52 C T 14: 64,113,633 A289V probably damaging Het
Puf60 T C 15: 76,070,874 K407E probably benign Het
Pzp T C 6: 128,485,617 D1455G probably damaging Het
Ranbp17 T C 11: 33,217,301 N1054S probably benign Het
Sdk2 A G 11: 113,793,741 S1965P probably benign Het
Spryd7 T C 14: 61,540,205 Y142C probably damaging Het
Srrt A T 5: 137,299,860 probably benign Het
Stk10 A G 11: 32,622,464 E935G possibly damaging Het
Tas2r115 G A 6: 132,737,971 R6C probably damaging Het
Tdrd7 T A 4: 45,987,681 probably benign Het
Trim29 A T 9: 43,332,376 Q564L probably damaging Het
Trim5 T C 7: 104,276,661 D231G probably damaging Het
Trpv2 A G 11: 62,596,961 K676E probably benign Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a2 A G 1: 88,201,438 I268V probably benign Het
Ugt8a T C 3: 125,874,203 N330D probably benign Het
Utrn G A 10: 12,475,296 H2822Y probably damaging Het
Vmn1r176 G A 7: 23,835,521 A69V probably benign Het
Vmn2r106 T C 17: 20,268,298 Y613C probably damaging Het
Wdfy1 A T 1: 79,709,140 W296R probably damaging Het
Zfp11 G A 5: 129,657,758 T213I possibly damaging Het
Zfp142 A T 1: 74,579,631 F193I probably damaging Het
Zfp764 G A 7: 127,405,567 Q131* probably null Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
R7960:C4b UTSW 17 34741278 splice site probably null
R8420:C4b UTSW 17 34734539 missense probably damaging 0.97
R8467:C4b UTSW 17 34732813 missense possibly damaging 0.51
R8558:C4b UTSW 17 34736567 missense probably damaging 1.00
R8725:C4b UTSW 17 34734485 missense probably damaging 1.00
R8727:C4b UTSW 17 34734485 missense probably damaging 1.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGGACTGCACCAGCCAGC -3'
(R):5'- ATCGACTAACTCAAACCAGAGAGGGTAA -3'

Sequencing Primer
(F):5'- AGCCAGCCTCCACCCTC -3'
(R):5'- ctcctttttctgtgataactcctg -3'
Posted On2014-05-23