Incidental Mutation 'R0081:Olfr352'
ID19656
Institutional Source Beutler Lab
Gene Symbol Olfr352
Ensembl Gene ENSMUSG00000053146
Gene Nameolfactory receptor 352
SynonymsGA_x6K02T2NLDC-33564136-33565083, MOR136-10
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0081 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36868460-36872785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36870010 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 148 (L148S)
Ref Sequence ENSEMBL: ENSMUSP00000149568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065416] [ENSMUST00000217325]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065416
AA Change: L148S

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070758
Gene: ENSMUSG00000053146
AA Change: L148S

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.4e-56 PFAM
Pfam:7TM_GPCR_Srsx 38 308 1.8e-7 PFAM
Pfam:7tm_1 44 293 1.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217325
AA Change: L148S

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Ddx41 A T 13: 55,535,380 H171Q possibly damaging Het
Dennd5b G T 6: 148,993,759 Q1258K probably benign Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Foxp2 T C 6: 15,405,644 probably benign Het
Frmd4a T C 2: 4,572,441 probably null Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
H1foo A G 6: 115,949,981 E273G probably benign Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Hk2 A T 6: 82,734,976 probably benign Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Il10ra T G 9: 45,255,949 M435L probably benign Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr344 T A 2: 36,568,881 Y94* probably null Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Olfr352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Olfr352 APN 2 36870210 missense probably benign 0.01
IGL01538:Olfr352 APN 2 36870520 utr 3 prime probably benign
IGL01716:Olfr352 APN 2 36869667 missense probably benign 0.11
IGL01735:Olfr352 APN 2 36869686 missense possibly damaging 0.95
IGL01998:Olfr352 APN 2 36869646 missense probably benign 0.01
IGL02820:Olfr352 APN 2 36869859 missense probably benign 0.01
IGL03267:Olfr352 APN 2 36870501 missense probably benign 0.00
IGL03306:Olfr352 APN 2 36870525 utr 3 prime probably benign
R0013:Olfr352 UTSW 2 36870160 missense probably damaging 1.00
R0421:Olfr352 UTSW 2 36869641 missense possibly damaging 0.89
R1613:Olfr352 UTSW 2 36870393 missense possibly damaging 0.91
R1842:Olfr352 UTSW 2 36869589 missense probably damaging 1.00
R2698:Olfr352 UTSW 2 36870196 missense possibly damaging 0.94
R4463:Olfr352 UTSW 2 36870193 missense probably benign 0.31
R4993:Olfr352 UTSW 2 36869988 missense probably benign 0.30
R5553:Olfr352 UTSW 2 36870465 missense probably benign 0.00
R5666:Olfr352 UTSW 2 36870389 missense probably benign 0.11
R5934:Olfr352 UTSW 2 36870268 missense probably benign 0.34
R6290:Olfr352 UTSW 2 36870436 missense probably damaging 1.00
R6312:Olfr352 UTSW 2 36870465 missense probably benign 0.02
R7358:Olfr352 UTSW 2 36869878 missense probably benign
X0022:Olfr352 UTSW 2 36870277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACACACAGTCAGTCCATCTC -3'
(R):5'- GGATTCAGCATGGGTGTGACCATAG -3'

Sequencing Primer
(F):5'- AGTCAGTCCATCTCATATACGGG -3'
(R):5'- TGGCTCCAATGTAGCCATAAG -3'
Posted On2013-04-11