Incidental Mutation 'R1771:Necab1'
ID 196560
Institutional Source Beutler Lab
Gene Symbol Necab1
Ensembl Gene ENSMUSG00000040536
Gene Name N-terminal EF-hand calcium binding protein 1
Synonyms NECAB1, STIP-1, Efcbp1, 1700003H21Rik
MMRRC Submission 039802-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1771 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 14952245-15149794 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15111267 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 54 (Y54H)
Ref Sequence ENSEMBL: ENSMUSP00000103908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041606] [ENSMUST00000108273]
AlphaFold Q8BG18
Predicted Effect probably damaging
Transcript: ENSMUST00000041606
AA Change: Y54H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038165
Gene: ENSMUSG00000040536
AA Change: Y54H

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108273
AA Change: Y54H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103908
Gene: ENSMUSG00000040536
AA Change: Y54H

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141105
Meta Mutation Damage Score 0.2259 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 106,773,061 (GRCm39) S642P probably damaging Het
Adam30 T C 3: 98,068,835 (GRCm39) S95P possibly damaging Het
Ahnak G A 19: 8,991,117 (GRCm39) V4134I probably benign Het
Ankrd13a T C 5: 114,941,649 (GRCm39) V512A probably benign Het
Asph A T 4: 9,598,773 (GRCm39) S149R probably damaging Het
Atp2b4 C A 1: 133,660,131 (GRCm39) V384L probably damaging Het
Atp8a1 A G 5: 67,805,074 (GRCm39) W1014R probably damaging Het
Cand1 A C 10: 119,044,211 (GRCm39) N1054K probably benign Het
Car15 A T 16: 17,654,730 (GRCm39) V96E probably damaging Het
Cd1d1 T C 3: 86,905,972 (GRCm39) E101G possibly damaging Het
Cd84 A G 1: 171,700,317 (GRCm39) T145A possibly damaging Het
Ceacam1 T A 7: 25,171,469 (GRCm39) T332S probably benign Het
Clca3a2 A T 3: 144,787,171 (GRCm39) V500E probably benign Het
Cul9 A T 17: 46,848,738 (GRCm39) M666K probably benign Het
Dennd3 A G 15: 73,426,950 (GRCm39) T776A possibly damaging Het
Dennd5a T C 7: 109,517,893 (GRCm39) D581G probably damaging Het
Dgkh A G 14: 78,846,967 (GRCm39) V371A probably damaging Het
Dhcr24 A G 4: 106,435,450 (GRCm39) T314A probably benign Het
Diaph1 G T 18: 38,024,071 (GRCm39) P589Q unknown Het
Disp2 C T 2: 118,621,778 (GRCm39) Q837* probably null Het
Dusp3 A T 11: 101,875,561 (GRCm39) M1K probably null Het
Ecpas A G 4: 58,879,100 (GRCm39) I63T probably damaging Het
Eddm13 G T 7: 6,280,541 (GRCm39) probably null Het
Erich3 A C 3: 154,454,109 (GRCm39) D625A possibly damaging Het
Fat2 G A 11: 55,201,691 (GRCm39) S461L probably benign Het
Fmn2 A G 1: 174,436,342 (GRCm39) probably benign Het
Foxi1 A G 11: 34,157,594 (GRCm39) Y144H probably damaging Het
Ftcd G A 10: 76,423,202 (GRCm39) V458M probably damaging Het
Gm3604 C A 13: 62,517,888 (GRCm39) G157* probably null Het
Gnpda1 C T 18: 38,466,380 (GRCm39) R79Q probably benign Het
Gpr65 T A 12: 98,242,259 (GRCm39) I304K probably damaging Het
Grem1 T C 2: 113,580,021 (GRCm39) E160G probably benign Het
Gria2 T A 3: 80,599,608 (GRCm39) K759* probably null Het
Gsg1l A G 7: 125,557,745 (GRCm39) S128P probably damaging Het
Hdac1 A T 4: 129,415,221 (GRCm39) I240N probably damaging Het
Hic2 C T 16: 17,076,578 (GRCm39) T469M probably benign Het
Hoxc10 A C 15: 102,875,522 (GRCm39) D77A probably damaging Het
Itprid1 T C 6: 55,875,132 (GRCm39) S361P probably benign Het
Klhl14 T A 18: 21,784,677 (GRCm39) H250L probably damaging Het
Klk1b24 A G 7: 43,837,653 (GRCm39) probably null Het
Letm1 T A 5: 33,926,811 (GRCm39) H162L probably damaging Het
Loxl3 A T 6: 83,026,890 (GRCm39) Y573F probably damaging Het
Macf1 A T 4: 123,405,901 (GRCm39) I330N probably damaging Het
Mchr1 T A 15: 81,121,436 (GRCm39) I62N probably damaging Het
Mcm8 C T 2: 132,685,476 (GRCm39) Q803* probably null Het
Msh3 T G 13: 92,349,004 (GRCm39) D1075A probably benign Het
Msh6 T A 17: 88,291,950 (GRCm39) V235D probably benign Het
Mthfd2l A T 5: 91,122,254 (GRCm39) D253V probably damaging Het
Mtor T C 4: 148,555,081 (GRCm39) V901A possibly damaging Het
Muc20 A T 16: 32,614,222 (GRCm39) I385N probably damaging Het
Myo6 G T 9: 80,193,082 (GRCm39) C829F probably damaging Het
Nbea T C 3: 55,841,940 (GRCm39) I1914V probably benign Het
Ncor1 T C 11: 62,217,938 (GRCm39) E1462G probably damaging Het
Nlrp4b A G 7: 10,452,520 (GRCm39) K15R probably damaging Het
Ntrk1 A G 3: 87,696,937 (GRCm39) S139P probably benign Het
Oas1d T C 5: 121,053,900 (GRCm39) F120S probably damaging Het
Ofd1 A G X: 165,189,002 (GRCm39) Y755H probably benign Het
Or10al2 A G 17: 37,983,554 (GRCm39) I213M probably damaging Het
Or13a25 A G 7: 140,248,048 (GRCm39) T276A probably benign Het
Or4f47 T G 2: 111,973,065 (GRCm39) Y258* probably null Het
Or5c1 T A 2: 37,222,430 (GRCm39) F224I probably benign Het
Or5p58 A C 7: 107,694,816 (GRCm39) probably null Het
Or9s27 A G 1: 92,516,837 (GRCm39) I262V probably benign Het
Plekha6 T C 1: 133,201,651 (GRCm39) S355P probably benign Het
Prdm14 T C 1: 13,189,082 (GRCm39) K421E probably damaging Het
Prss36 A G 7: 127,532,625 (GRCm39) L731P probably damaging Het
Rad51d A G 11: 82,774,764 (GRCm39) L97P probably damaging Het
Rbl1 C A 2: 157,005,454 (GRCm39) probably null Het
Rnh1 G T 7: 140,744,519 (GRCm39) A52D possibly damaging Het
Rps24 A G 14: 24,541,830 (GRCm39) T6A probably damaging Het
Ryr2 A C 13: 11,760,062 (GRCm39) probably null Het
Samd4 A T 14: 47,326,532 (GRCm39) N454I probably damaging Het
Sap130 T C 18: 31,769,135 (GRCm39) I32T probably benign Het
Sap30l A T 11: 57,696,925 (GRCm39) N85I probably damaging Het
Sbf2 G A 7: 110,060,353 (GRCm39) Q204* probably null Het
Slc45a3 T C 1: 131,904,694 (GRCm39) W6R possibly damaging Het
Snx16 A G 3: 10,484,221 (GRCm39) V334A probably damaging Het
Soat1 C T 1: 156,269,991 (GRCm39) V143I probably benign Het
Sp8 T A 12: 118,813,302 (GRCm39) F386I probably damaging Het
Spag6 C T 2: 18,738,928 (GRCm39) S286L probably benign Het
Srpra A T 9: 35,124,147 (GRCm39) N31I possibly damaging Het
Ssbp4 A G 8: 71,051,502 (GRCm39) probably null Het
Stxbp2 G T 8: 3,684,064 (GRCm39) A124S probably benign Het
Tacc2 A G 7: 130,343,970 (GRCm39) K700R probably damaging Het
Tatdn2 A T 6: 113,679,060 (GRCm39) probably null Het
Tecrl G A 5: 83,439,134 (GRCm39) T226I probably damaging Het
Timeless T G 10: 128,083,477 (GRCm39) V702G probably benign Het
Tjp1 A T 7: 64,962,753 (GRCm39) S1061R probably benign Het
Tmem39b A T 4: 129,587,011 (GRCm39) C67S probably damaging Het
Tstd3 T C 4: 21,759,475 (GRCm39) Y99C probably damaging Het
Ttc39c T A 18: 12,817,881 (GRCm39) probably null Het
Ttll7 C T 3: 146,600,160 (GRCm39) P23S probably benign Het
Uba5 A G 9: 103,927,107 (GRCm39) F290S probably damaging Het
Ubap2l T C 3: 89,926,538 (GRCm39) Y623C probably damaging Het
Ube3a A G 7: 58,925,714 (GRCm39) E164G probably damaging Het
Ugcg A G 4: 59,207,775 (GRCm39) N38S probably benign Het
Ugp2 G A 11: 21,279,915 (GRCm39) T283I probably damaging Het
Vmn1r55 A T 7: 5,149,919 (GRCm39) I168N probably benign Het
Wdr27 A C 17: 15,112,703 (GRCm39) S668A probably damaging Het
Wnt2 T A 6: 18,008,696 (GRCm39) N247I probably damaging Het
Zfp850 A T 7: 27,684,700 (GRCm39) C15* probably null Het
Zfp959 A G 17: 56,204,677 (GRCm39) probably null Het
Other mutations in Necab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Necab1 APN 4 15,052,656 (GRCm39) missense probably damaging 1.00
IGL01314:Necab1 APN 4 15,005,079 (GRCm39) missense probably damaging 0.96
IGL01751:Necab1 APN 4 14,978,171 (GRCm39) missense probably damaging 1.00
IGL02098:Necab1 APN 4 14,955,892 (GRCm39) utr 3 prime probably benign
IGL02381:Necab1 APN 4 15,148,812 (GRCm39) splice site probably null
IGL03247:Necab1 APN 4 14,960,046 (GRCm39) missense probably benign
R0095:Necab1 UTSW 4 14,960,027 (GRCm39) missense possibly damaging 0.95
R0095:Necab1 UTSW 4 14,960,027 (GRCm39) missense possibly damaging 0.95
R0321:Necab1 UTSW 4 14,960,083 (GRCm39) missense probably damaging 0.99
R0698:Necab1 UTSW 4 15,005,041 (GRCm39) missense probably benign 0.26
R1125:Necab1 UTSW 4 15,111,257 (GRCm39) missense probably damaging 1.00
R1251:Necab1 UTSW 4 15,111,192 (GRCm39) critical splice donor site probably null
R1400:Necab1 UTSW 4 14,975,185 (GRCm39) missense possibly damaging 0.71
R1505:Necab1 UTSW 4 14,960,047 (GRCm39) missense probably benign 0.26
R1776:Necab1 UTSW 4 15,111,267 (GRCm39) missense probably damaging 1.00
R2080:Necab1 UTSW 4 15,140,219 (GRCm39) splice site probably benign
R4705:Necab1 UTSW 4 15,052,628 (GRCm39) missense probably damaging 1.00
R4780:Necab1 UTSW 4 14,989,248 (GRCm39) missense probably benign 0.18
R4795:Necab1 UTSW 4 15,111,208 (GRCm39) missense possibly damaging 0.84
R4972:Necab1 UTSW 4 14,978,216 (GRCm39) missense probably damaging 1.00
R5009:Necab1 UTSW 4 14,947,503 (GRCm39) unclassified probably benign
R6102:Necab1 UTSW 4 14,989,211 (GRCm39) missense probably benign 0.05
R6968:Necab1 UTSW 4 14,957,852 (GRCm39) missense probably damaging 1.00
R7458:Necab1 UTSW 4 15,111,244 (GRCm39) missense possibly damaging 0.90
R8130:Necab1 UTSW 4 15,005,073 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTAAACAAGCAGTGCATCTCTG -3'
(R):5'- GCCATACACCAGTGCATGTTTCG -3'

Sequencing Primer
(F):5'- GGTATCCACATGCCAAGTAAATG -3'
(R):5'- GACATTGCAAAGGTTTCCTTCTTG -3'
Posted On 2014-05-23