Incidental Mutation 'R1771:Dhcr24'
ID196564
Institutional Source Beutler Lab
Gene Symbol Dhcr24
Ensembl Gene ENSMUSG00000034926
Gene Name24-dehydrocholesterol reductase
Synonyms2310076D10Rik, seladin-1, 5830417J06Rik, 3-beta-hydroxysterol delta-24 reductase
MMRRC Submission 039802-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R1771 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106561038-106589113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106578253 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 314 (T314A)
Ref Sequence ENSEMBL: ENSMUSP00000038063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047973]
Predicted Effect probably benign
Transcript: ENSMUST00000047973
AA Change: T314A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038063
Gene: ENSMUSG00000034926
AA Change: T314A

DomainStartEndE-ValueType
Pfam:FAD_binding_4 71 203 2e-16 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin adenine dinucleotide (FAD)-dependent oxidoreductase which catalyzes the reduction of the delta-24 double bond of sterol intermediates during cholesterol biosynthesis. The protein contains a leader sequence that directs it to the endoplasmic reticulum membrane. Missense mutations in this gene have been associated with desmosterolosis. Also, reduced expression of the gene occurs in the temporal cortex of Alzheimer disease patients and overexpression has been observed in adrenal gland cancer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of having almost no plasma or tissue cholesterol, homozygous mutant mice are largely viable and display a mild growth phenotype. Inactivation did impair prenatal viability as well as infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 106,937,200 S642P probably damaging Het
Adam30 T C 3: 98,161,519 S95P possibly damaging Het
Ahnak G A 19: 9,013,753 V4134I probably benign Het
AI314180 A G 4: 58,879,100 I63T probably damaging Het
Ankrd13a T C 5: 114,803,588 V512A probably benign Het
Asph A T 4: 9,598,773 S149R probably damaging Het
Atp2b4 C A 1: 133,732,393 V384L probably damaging Het
Atp8a1 A G 5: 67,647,731 W1014R probably damaging Het
Cand1 A C 10: 119,208,306 N1054K probably benign Het
Car15 A T 16: 17,836,866 V96E probably damaging Het
Ccdc129 T C 6: 55,898,147 S361P probably benign Het
Cd1d1 T C 3: 86,998,665 E101G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam1 T A 7: 25,472,044 T332S probably benign Het
Clca2 A T 3: 145,081,410 V500E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dennd3 A G 15: 73,555,101 T776A possibly damaging Het
Dennd5a T C 7: 109,918,686 D581G probably damaging Het
Dgkh A G 14: 78,609,527 V371A probably damaging Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Disp2 C T 2: 118,791,297 Q837* probably null Het
Dusp3 A T 11: 101,984,735 M1K probably null Het
Epp13 G T 7: 6,277,542 probably null Het
Erich3 A C 3: 154,748,472 D625A possibly damaging Het
Fat2 G A 11: 55,310,865 S461L probably benign Het
Fmn2 A G 1: 174,608,776 probably benign Het
Foxi1 A G 11: 34,207,594 Y144H probably damaging Het
Ftcd G A 10: 76,587,368 V458M probably damaging Het
Gm3604 C A 13: 62,370,074 G157* probably null Het
Gnpda1 C T 18: 38,333,327 R79Q probably benign Het
Gpr65 T A 12: 98,276,000 I304K probably damaging Het
Grem1 T C 2: 113,749,676 E160G probably benign Het
Gria2 T A 3: 80,692,301 K759* probably null Het
Gsg1l A G 7: 125,958,573 S128P probably damaging Het
Hdac1 A T 4: 129,521,428 I240N probably damaging Het
Hic2 C T 16: 17,258,714 T469M probably benign Het
Hoxc10 A C 15: 102,967,087 D77A probably damaging Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Klk1b24 A G 7: 44,188,229 probably null Het
Letm1 T A 5: 33,769,467 H162L probably damaging Het
Loxl3 A T 6: 83,049,909 Y573F probably damaging Het
Macf1 A T 4: 123,512,108 I330N probably damaging Het
Mchr1 T A 15: 81,237,235 I62N probably damaging Het
Mcm8 C T 2: 132,843,556 Q803* probably null Het
Msh3 T G 13: 92,212,496 D1075A probably benign Het
Msh6 T A 17: 87,984,522 V235D probably benign Het
Mthfd2l A T 5: 90,974,395 D253V probably damaging Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Muc20 A T 16: 32,793,852 I385N probably damaging Het
Myo6 G T 9: 80,285,800 C829F probably damaging Het
Nbea T C 3: 55,934,519 I1914V probably benign Het
Ncor1 T C 11: 62,327,112 E1462G probably damaging Het
Necab1 A G 4: 15,111,267 Y54H probably damaging Het
Nlrp4b A G 7: 10,718,593 K15R probably damaging Het
Ntrk1 A G 3: 87,789,630 S139P probably benign Het
Oas1d T C 5: 120,915,837 F120S probably damaging Het
Ofd1 A G X: 166,406,006 Y755H probably benign Het
Olfr118 A G 17: 37,672,663 I213M probably damaging Het
Olfr1317 T G 2: 112,142,720 Y258* probably null Het
Olfr1412 A G 1: 92,589,115 I262V probably benign Het
Olfr368 T A 2: 37,332,418 F224I probably benign Het
Olfr482 A C 7: 108,095,609 probably null Het
Olfr539 A G 7: 140,668,135 T276A probably benign Het
Plekha6 T C 1: 133,273,913 S355P probably benign Het
Prdm14 T C 1: 13,118,858 K421E probably damaging Het
Prss36 A G 7: 127,933,453 L731P probably damaging Het
Rad51d A G 11: 82,883,938 L97P probably damaging Het
Rbl1 C A 2: 157,163,534 probably null Het
Rnh1 G T 7: 141,164,606 A52D possibly damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Ryr2 A C 13: 11,745,176 probably null Het
Samd4 A T 14: 47,089,075 N454I probably damaging Het
Sap130 T C 18: 31,636,082 I32T probably benign Het
Sap30l A T 11: 57,806,099 N85I probably damaging Het
Sbf2 G A 7: 110,461,146 Q204* probably null Het
Slc45a3 T C 1: 131,976,956 W6R possibly damaging Het
Snx16 A G 3: 10,419,161 V334A probably damaging Het
Soat1 C T 1: 156,442,421 V143I probably benign Het
Sp8 T A 12: 118,849,567 F386I probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Srpr A T 9: 35,212,851 N31I possibly damaging Het
Ssbp4 A G 8: 70,598,852 probably null Het
Stxbp2 G T 8: 3,634,064 A124S probably benign Het
Tacc2 A G 7: 130,742,240 K700R probably damaging Het
Tatdn2 A T 6: 113,702,099 probably null Het
Tecrl G A 5: 83,291,287 T226I probably damaging Het
Timeless T G 10: 128,247,608 V702G probably benign Het
Tjp1 A T 7: 65,313,005 S1061R probably benign Het
Tmem39b A T 4: 129,693,218 C67S probably damaging Het
Tstd3 T C 4: 21,759,475 Y99C probably damaging Het
Ttc39c T A 18: 12,684,824 probably null Het
Ttll7 C T 3: 146,894,405 P23S probably benign Het
Uba5 A G 9: 104,049,908 F290S probably damaging Het
Ubap2l T C 3: 90,019,231 Y623C probably damaging Het
Ube3a A G 7: 59,275,966 E164G probably damaging Het
Ugcg A G 4: 59,207,775 N38S probably benign Het
Ugp2 G A 11: 21,329,915 T283I probably damaging Het
Vmn1r55 A T 7: 5,146,920 I168N probably benign Het
Wdr27 A C 17: 14,892,441 S668A probably damaging Het
Wnt2 T A 6: 18,008,697 N247I probably damaging Het
Zfp850 A T 7: 27,985,275 C15* probably null Het
Zfp959 A G 17: 55,897,677 probably null Het
Other mutations in Dhcr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Dhcr24 APN 4 106572278 missense possibly damaging 0.50
IGL01548:Dhcr24 APN 4 106573871 nonsense probably null
IGL02110:Dhcr24 APN 4 106573801 missense probably damaging 1.00
IGL02256:Dhcr24 APN 4 106572320 missense probably damaging 0.98
IGL02748:Dhcr24 APN 4 106564392 splice site probably benign
IGL02926:Dhcr24 APN 4 106586355 missense probably damaging 0.98
ANU22:Dhcr24 UTSW 4 106572278 missense possibly damaging 0.50
R0423:Dhcr24 UTSW 4 106586536 unclassified probably benign
R1632:Dhcr24 UTSW 4 106585951 missense probably benign
R2138:Dhcr24 UTSW 4 106572302 nonsense probably null
R2139:Dhcr24 UTSW 4 106572302 nonsense probably null
R2420:Dhcr24 UTSW 4 106561094 start gained probably benign
R2422:Dhcr24 UTSW 4 106561094 start gained probably benign
R2570:Dhcr24 UTSW 4 106585832 missense probably benign 0.00
R3176:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3276:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3842:Dhcr24 UTSW 4 106585805 missense probably damaging 1.00
R3852:Dhcr24 UTSW 4 106573873 missense probably benign 0.02
R4037:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4038:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4039:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R5831:Dhcr24 UTSW 4 106564414 missense probably benign 0.03
R7285:Dhcr24 UTSW 4 106571519 critical splice donor site probably null
R7821:Dhcr24 UTSW 4 106571436 missense possibly damaging 0.61
R8012:Dhcr24 UTSW 4 106586656 missense probably damaging 1.00
X0057:Dhcr24 UTSW 4 106586345 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCAAAGGCCAAACGCATTAGAC -3'
(R):5'- TCTGCTCGGCAATGGTAACACTTC -3'

Sequencing Primer
(F):5'- TTAGACAGCGGCTGGATCG -3'
(R):5'- AGGTCTACCTTTTCCCAAAGTGAG -3'
Posted On2014-05-23