Incidental Mutation 'R1771:Tjp1'
ID196589
Institutional Source Beutler Lab
Gene Symbol Tjp1
Ensembl Gene ENSMUSG00000030516
Gene Nametight junction protein 1
SynonymsZO1, ZO-1
MMRRC Submission 039802-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1771 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location65296165-65527781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65313005 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1061 (S1061R)
Ref Sequence ENSEMBL: ENSMUSP00000032729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032729] [ENSMUST00000102592] [ENSMUST00000206612]
Predicted Effect probably benign
Transcript: ENSMUST00000032729
AA Change: S1061R

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032729
Gene: ENSMUSG00000030516
AA Change: S1061R

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 1157 1176 N/A INTRINSIC
low complexity region 1246 1257 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1339 1365 N/A INTRINSIC
low complexity region 1389 1400 N/A INTRINSIC
ZU5 1549 1654 1.1e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102592
AA Change: S1141R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099652
Gene: ENSMUSG00000030516
AA Change: S1141R

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 939 955 N/A INTRINSIC
low complexity region 1237 1256 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1388 1399 N/A INTRINSIC
low complexity region 1419 1445 N/A INTRINSIC
low complexity region 1469 1480 N/A INTRINSIC
ZU5 1629 1735 1.84e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206612
AA Change: S1061R

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein located on a cytoplasmic membrane surface of intercellular tight junctions. The encoded protein may be involved in signal transduction at cell-cell junctions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality and growth retardation, failure of embryo turning and chorioallantoic fusion, defective yolk sac angiogenesis, and increased apoptosis in the notochord, neural tube, somite and allantois. Homozygotes for a reporter allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 106,937,200 S642P probably damaging Het
Adam30 T C 3: 98,161,519 S95P possibly damaging Het
Ahnak G A 19: 9,013,753 V4134I probably benign Het
AI314180 A G 4: 58,879,100 I63T probably damaging Het
Ankrd13a T C 5: 114,803,588 V512A probably benign Het
Asph A T 4: 9,598,773 S149R probably damaging Het
Atp2b4 C A 1: 133,732,393 V384L probably damaging Het
Atp8a1 A G 5: 67,647,731 W1014R probably damaging Het
Cand1 A C 10: 119,208,306 N1054K probably benign Het
Car15 A T 16: 17,836,866 V96E probably damaging Het
Ccdc129 T C 6: 55,898,147 S361P probably benign Het
Cd1d1 T C 3: 86,998,665 E101G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam1 T A 7: 25,472,044 T332S probably benign Het
Clca2 A T 3: 145,081,410 V500E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dennd3 A G 15: 73,555,101 T776A possibly damaging Het
Dennd5a T C 7: 109,918,686 D581G probably damaging Het
Dgkh A G 14: 78,609,527 V371A probably damaging Het
Dhcr24 A G 4: 106,578,253 T314A probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Disp2 C T 2: 118,791,297 Q837* probably null Het
Dusp3 A T 11: 101,984,735 M1K probably null Het
Epp13 G T 7: 6,277,542 probably null Het
Erich3 A C 3: 154,748,472 D625A possibly damaging Het
Fat2 G A 11: 55,310,865 S461L probably benign Het
Fmn2 A G 1: 174,608,776 probably benign Het
Foxi1 A G 11: 34,207,594 Y144H probably damaging Het
Ftcd G A 10: 76,587,368 V458M probably damaging Het
Gm3604 C A 13: 62,370,074 G157* probably null Het
Gnpda1 C T 18: 38,333,327 R79Q probably benign Het
Gpr65 T A 12: 98,276,000 I304K probably damaging Het
Grem1 T C 2: 113,749,676 E160G probably benign Het
Gria2 T A 3: 80,692,301 K759* probably null Het
Gsg1l A G 7: 125,958,573 S128P probably damaging Het
Hdac1 A T 4: 129,521,428 I240N probably damaging Het
Hic2 C T 16: 17,258,714 T469M probably benign Het
Hoxc10 A C 15: 102,967,087 D77A probably damaging Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Klk1b24 A G 7: 44,188,229 probably null Het
Letm1 T A 5: 33,769,467 H162L probably damaging Het
Loxl3 A T 6: 83,049,909 Y573F probably damaging Het
Macf1 A T 4: 123,512,108 I330N probably damaging Het
Mchr1 T A 15: 81,237,235 I62N probably damaging Het
Mcm8 C T 2: 132,843,556 Q803* probably null Het
Msh3 T G 13: 92,212,496 D1075A probably benign Het
Msh6 T A 17: 87,984,522 V235D probably benign Het
Mthfd2l A T 5: 90,974,395 D253V probably damaging Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Muc20 A T 16: 32,793,852 I385N probably damaging Het
Myo6 G T 9: 80,285,800 C829F probably damaging Het
Nbea T C 3: 55,934,519 I1914V probably benign Het
Ncor1 T C 11: 62,327,112 E1462G probably damaging Het
Necab1 A G 4: 15,111,267 Y54H probably damaging Het
Nlrp4b A G 7: 10,718,593 K15R probably damaging Het
Ntrk1 A G 3: 87,789,630 S139P probably benign Het
Oas1d T C 5: 120,915,837 F120S probably damaging Het
Ofd1 A G X: 166,406,006 Y755H probably benign Het
Olfr118 A G 17: 37,672,663 I213M probably damaging Het
Olfr1317 T G 2: 112,142,720 Y258* probably null Het
Olfr1412 A G 1: 92,589,115 I262V probably benign Het
Olfr368 T A 2: 37,332,418 F224I probably benign Het
Olfr482 A C 7: 108,095,609 probably null Het
Olfr539 A G 7: 140,668,135 T276A probably benign Het
Plekha6 T C 1: 133,273,913 S355P probably benign Het
Prdm14 T C 1: 13,118,858 K421E probably damaging Het
Prss36 A G 7: 127,933,453 L731P probably damaging Het
Rad51d A G 11: 82,883,938 L97P probably damaging Het
Rbl1 C A 2: 157,163,534 probably null Het
Rnh1 G T 7: 141,164,606 A52D possibly damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Ryr2 A C 13: 11,745,176 probably null Het
Samd4 A T 14: 47,089,075 N454I probably damaging Het
Sap130 T C 18: 31,636,082 I32T probably benign Het
Sap30l A T 11: 57,806,099 N85I probably damaging Het
Sbf2 G A 7: 110,461,146 Q204* probably null Het
Slc45a3 T C 1: 131,976,956 W6R possibly damaging Het
Snx16 A G 3: 10,419,161 V334A probably damaging Het
Soat1 C T 1: 156,442,421 V143I probably benign Het
Sp8 T A 12: 118,849,567 F386I probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Srpr A T 9: 35,212,851 N31I possibly damaging Het
Ssbp4 A G 8: 70,598,852 probably null Het
Stxbp2 G T 8: 3,634,064 A124S probably benign Het
Tacc2 A G 7: 130,742,240 K700R probably damaging Het
Tatdn2 A T 6: 113,702,099 probably null Het
Tecrl G A 5: 83,291,287 T226I probably damaging Het
Timeless T G 10: 128,247,608 V702G probably benign Het
Tmem39b A T 4: 129,693,218 C67S probably damaging Het
Tstd3 T C 4: 21,759,475 Y99C probably damaging Het
Ttc39c T A 18: 12,684,824 probably null Het
Ttll7 C T 3: 146,894,405 P23S probably benign Het
Uba5 A G 9: 104,049,908 F290S probably damaging Het
Ubap2l T C 3: 90,019,231 Y623C probably damaging Het
Ube3a A G 7: 59,275,966 E164G probably damaging Het
Ugcg A G 4: 59,207,775 N38S probably benign Het
Ugp2 G A 11: 21,329,915 T283I probably damaging Het
Vmn1r55 A T 7: 5,146,920 I168N probably benign Het
Wdr27 A C 17: 14,892,441 S668A probably damaging Het
Wnt2 T A 6: 18,008,697 N247I probably damaging Het
Zfp850 A T 7: 27,985,275 C15* probably null Het
Zfp959 A G 17: 55,897,677 probably null Het
Other mutations in Tjp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tjp1 APN 7 65301219 missense probably benign
IGL00848:Tjp1 APN 7 65303194 missense probably benign 0.00
IGL01363:Tjp1 APN 7 65302965 missense possibly damaging 0.94
IGL01526:Tjp1 APN 7 65322658 missense probably damaging 1.00
IGL01607:Tjp1 APN 7 65336178 missense possibly damaging 0.94
IGL02223:Tjp1 APN 7 65322601 missense probably damaging 1.00
IGL02341:Tjp1 APN 7 65312634 missense probably damaging 1.00
IGL02347:Tjp1 APN 7 65301064 critical splice donor site probably null
IGL02452:Tjp1 APN 7 65312655 missense probably damaging 1.00
IGL02512:Tjp1 APN 7 65343667 missense probably damaging 1.00
IGL02552:Tjp1 APN 7 65299782 nonsense probably null
IGL02707:Tjp1 APN 7 65329683 nonsense probably null
IGL02707:Tjp1 APN 7 65329682 missense possibly damaging 0.85
IGL02939:Tjp1 APN 7 65314890 missense probably damaging 1.00
IGL03139:Tjp1 APN 7 65340434 splice site probably benign
IGL03273:Tjp1 APN 7 65299799 missense probably damaging 1.00
IGL03391:Tjp1 APN 7 65314969 missense probably damaging 1.00
PIT4453001:Tjp1 UTSW 7 65343614 critical splice donor site probably null
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0390:Tjp1 UTSW 7 65314990 missense probably damaging 1.00
R0519:Tjp1 UTSW 7 65302921 missense probably benign
R0653:Tjp1 UTSW 7 65314755 missense probably damaging 1.00
R1163:Tjp1 UTSW 7 65323054 missense probably damaging 1.00
R1544:Tjp1 UTSW 7 65302921 missense probably benign
R1634:Tjp1 UTSW 7 65302952 missense possibly damaging 0.94
R1767:Tjp1 UTSW 7 65312553 critical splice donor site probably null
R1794:Tjp1 UTSW 7 65323129 missense probably damaging 1.00
R1874:Tjp1 UTSW 7 65319253 missense probably damaging 1.00
R1971:Tjp1 UTSW 7 65324078 missense probably damaging 1.00
R1981:Tjp1 UTSW 7 65312855 missense probably damaging 0.99
R2086:Tjp1 UTSW 7 65312921 missense probably damaging 1.00
R2310:Tjp1 UTSW 7 65329742 missense possibly damaging 0.90
R2942:Tjp1 UTSW 7 65318006 missense probably damaging 1.00
R3974:Tjp1 UTSW 7 65297639 nonsense probably null
R4295:Tjp1 UTSW 7 65323150 missense probably damaging 1.00
R4296:Tjp1 UTSW 7 65318489 missense probably damaging 1.00
R4567:Tjp1 UTSW 7 65306501 missense probably damaging 1.00
R4574:Tjp1 UTSW 7 65322605 missense probably damaging 1.00
R4910:Tjp1 UTSW 7 65343727 missense probably damaging 1.00
R4958:Tjp1 UTSW 7 65336102 nonsense probably null
R5267:Tjp1 UTSW 7 65323049 missense probably damaging 1.00
R5371:Tjp1 UTSW 7 65313311 nonsense probably null
R5422:Tjp1 UTSW 7 65302967 missense probably damaging 0.99
R5514:Tjp1 UTSW 7 65354861 missense probably damaging 1.00
R5652:Tjp1 UTSW 7 65312443 splice site probably null
R5693:Tjp1 UTSW 7 65342663 missense possibly damaging 0.96
R5933:Tjp1 UTSW 7 65302852 missense probably benign 0.29
R6043:Tjp1 UTSW 7 65324089 missense probably damaging 1.00
R6416:Tjp1 UTSW 7 65313205 missense possibly damaging 0.76
R6491:Tjp1 UTSW 7 65337117 missense possibly damaging 0.62
R6525:Tjp1 UTSW 7 65343651 missense probably damaging 1.00
R6658:Tjp1 UTSW 7 65301077 missense possibly damaging 0.82
R6917:Tjp1 UTSW 7 65299688 missense probably damaging 0.99
R6960:Tjp1 UTSW 7 65303015 missense possibly damaging 0.59
R7235:Tjp1 UTSW 7 65318573 missense probably benign 0.16
R7274:Tjp1 UTSW 7 65527652 missense possibly damaging 0.86
R7471:Tjp1 UTSW 7 65314690 missense probably damaging 0.99
R7475:Tjp1 UTSW 7 65322339 missense probably damaging 1.00
R7479:Tjp1 UTSW 7 65301180 missense probably damaging 0.98
R8035:Tjp1 UTSW 7 65342702 missense probably benign 0.34
R8195:Tjp1 UTSW 7 65343722 missense probably damaging 1.00
R8276:Tjp1 UTSW 7 65343796 intron probably benign
R8817:Tjp1 UTSW 7 65303062 missense probably benign 0.41
R8869:Tjp1 UTSW 7 65336638 missense probably damaging 1.00
X0022:Tjp1 UTSW 7 65302841 missense possibly damaging 0.75
X0027:Tjp1 UTSW 7 65314759 missense probably benign 0.18
Z1177:Tjp1 UTSW 7 65343732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGTGGTGGAACTTGCTCATAAC -3'
(R):5'- AAGCTACACAGACCAGTTTTCTCGG -3'

Sequencing Primer
(F):5'- GGAACTTGCTCATAACTTCGC -3'
(R):5'- CGGTTTGAAGATCGAATCCCTAC -3'
Posted On2014-05-23