Incidental Mutation 'R1771:Srpr'
ID196602
Institutional Source Beutler Lab
Gene Symbol Srpr
Ensembl Gene ENSMUSG00000032042
Gene Namesignal recognition particle receptor ('docking protein')
SynonymsD11Mgi27, 1300011P19Rik
MMRRC Submission 039802-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1771 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35200175-35247973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35212851 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 31 (N31I)
Ref Sequence ENSEMBL: ENSMUSP00000149923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034541] [ENSMUST00000043805] [ENSMUST00000059057] [ENSMUST00000063782] [ENSMUST00000121564] [ENSMUST00000127996] [ENSMUST00000132799] [ENSMUST00000138287] [ENSMUST00000138692] [ENSMUST00000139703] [ENSMUST00000142595] [ENSMUST00000154691] [ENSMUST00000151658]
Predicted Effect probably benign
Transcript: ENSMUST00000034541
AA Change: N166I

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034541
Gene: ENSMUSG00000032042
AA Change: N166I

DomainStartEndE-ValueType
Pfam:SRP-alpha_N 27 301 4.4e-69 PFAM
SRP54_N 318 395 4.04e-6 SMART
AAA 415 568 9.65e-10 SMART
SRP54 416 635 3.47e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043805
SMART Domains Protein: ENSMUSP00000038924
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 462 2.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059057
SMART Domains Protein: ENSMUSP00000058377
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063782
SMART Domains Protein: ENSMUSP00000066281
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
Pfam:SIR2_2 75 225 7.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121564
SMART Domains Protein: ENSMUSP00000113537
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127996
SMART Domains Protein: ENSMUSP00000118037
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 456 1.8e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130072
Predicted Effect probably benign
Transcript: ENSMUST00000132799
SMART Domains Protein: ENSMUSP00000115104
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP54 3 132 8.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133739
SMART Domains Protein: ENSMUSP00000121690
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138287
AA Change: N31I

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000138692
SMART Domains Protein: ENSMUSP00000120556
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139703
SMART Domains Protein: ENSMUSP00000122535
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 184 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142595
SMART Domains Protein: ENSMUSP00000117147
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 187 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151082
Predicted Effect probably benign
Transcript: ENSMUST00000154691
SMART Domains Protein: ENSMUSP00000123496
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151658
SMART Domains Protein: ENSMUSP00000120284
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 121 5.8e-9 PFAM
low complexity region 128 138 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a subunit of the endoplasmic reticulum signal recognition particle receptor that, in conjunction with the signal recognition particle, is involved in the targeting and translocation of signal sequence tagged secretory and membrane proteins across the endoplasmic reticulum. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 106,937,200 S642P probably damaging Het
Adam30 T C 3: 98,161,519 S95P possibly damaging Het
Ahnak G A 19: 9,013,753 V4134I probably benign Het
AI314180 A G 4: 58,879,100 I63T probably damaging Het
Ankrd13a T C 5: 114,803,588 V512A probably benign Het
Asph A T 4: 9,598,773 S149R probably damaging Het
Atp2b4 C A 1: 133,732,393 V384L probably damaging Het
Atp8a1 A G 5: 67,647,731 W1014R probably damaging Het
Cand1 A C 10: 119,208,306 N1054K probably benign Het
Car15 A T 16: 17,836,866 V96E probably damaging Het
Ccdc129 T C 6: 55,898,147 S361P probably benign Het
Cd1d1 T C 3: 86,998,665 E101G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam1 T A 7: 25,472,044 T332S probably benign Het
Clca2 A T 3: 145,081,410 V500E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dennd3 A G 15: 73,555,101 T776A possibly damaging Het
Dennd5a T C 7: 109,918,686 D581G probably damaging Het
Dgkh A G 14: 78,609,527 V371A probably damaging Het
Dhcr24 A G 4: 106,578,253 T314A probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Disp2 C T 2: 118,791,297 Q837* probably null Het
Dusp3 A T 11: 101,984,735 M1K probably null Het
Epp13 G T 7: 6,277,542 probably null Het
Erich3 A C 3: 154,748,472 D625A possibly damaging Het
Fat2 G A 11: 55,310,865 S461L probably benign Het
Fmn2 A G 1: 174,608,776 probably benign Het
Foxi1 A G 11: 34,207,594 Y144H probably damaging Het
Ftcd G A 10: 76,587,368 V458M probably damaging Het
Gm3604 C A 13: 62,370,074 G157* probably null Het
Gnpda1 C T 18: 38,333,327 R79Q probably benign Het
Gpr65 T A 12: 98,276,000 I304K probably damaging Het
Grem1 T C 2: 113,749,676 E160G probably benign Het
Gria2 T A 3: 80,692,301 K759* probably null Het
Gsg1l A G 7: 125,958,573 S128P probably damaging Het
Hdac1 A T 4: 129,521,428 I240N probably damaging Het
Hic2 C T 16: 17,258,714 T469M probably benign Het
Hoxc10 A C 15: 102,967,087 D77A probably damaging Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Klk1b24 A G 7: 44,188,229 probably null Het
Letm1 T A 5: 33,769,467 H162L probably damaging Het
Loxl3 A T 6: 83,049,909 Y573F probably damaging Het
Macf1 A T 4: 123,512,108 I330N probably damaging Het
Mchr1 T A 15: 81,237,235 I62N probably damaging Het
Mcm8 C T 2: 132,843,556 Q803* probably null Het
Msh3 T G 13: 92,212,496 D1075A probably benign Het
Msh6 T A 17: 87,984,522 V235D probably benign Het
Mthfd2l A T 5: 90,974,395 D253V probably damaging Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Muc20 A T 16: 32,793,852 I385N probably damaging Het
Myo6 G T 9: 80,285,800 C829F probably damaging Het
Nbea T C 3: 55,934,519 I1914V probably benign Het
Ncor1 T C 11: 62,327,112 E1462G probably damaging Het
Necab1 A G 4: 15,111,267 Y54H probably damaging Het
Nlrp4b A G 7: 10,718,593 K15R probably damaging Het
Ntrk1 A G 3: 87,789,630 S139P probably benign Het
Oas1d T C 5: 120,915,837 F120S probably damaging Het
Ofd1 A G X: 166,406,006 Y755H probably benign Het
Olfr118 A G 17: 37,672,663 I213M probably damaging Het
Olfr1317 T G 2: 112,142,720 Y258* probably null Het
Olfr1412 A G 1: 92,589,115 I262V probably benign Het
Olfr368 T A 2: 37,332,418 F224I probably benign Het
Olfr482 A C 7: 108,095,609 probably null Het
Olfr539 A G 7: 140,668,135 T276A probably benign Het
Plekha6 T C 1: 133,273,913 S355P probably benign Het
Prdm14 T C 1: 13,118,858 K421E probably damaging Het
Prss36 A G 7: 127,933,453 L731P probably damaging Het
Rad51d A G 11: 82,883,938 L97P probably damaging Het
Rbl1 C A 2: 157,163,534 probably null Het
Rnh1 G T 7: 141,164,606 A52D possibly damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Ryr2 A C 13: 11,745,176 probably null Het
Samd4 A T 14: 47,089,075 N454I probably damaging Het
Sap130 T C 18: 31,636,082 I32T probably benign Het
Sap30l A T 11: 57,806,099 N85I probably damaging Het
Sbf2 G A 7: 110,461,146 Q204* probably null Het
Slc45a3 T C 1: 131,976,956 W6R possibly damaging Het
Snx16 A G 3: 10,419,161 V334A probably damaging Het
Soat1 C T 1: 156,442,421 V143I probably benign Het
Sp8 T A 12: 118,849,567 F386I probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Ssbp4 A G 8: 70,598,852 probably null Het
Stxbp2 G T 8: 3,634,064 A124S probably benign Het
Tacc2 A G 7: 130,742,240 K700R probably damaging Het
Tatdn2 A T 6: 113,702,099 probably null Het
Tecrl G A 5: 83,291,287 T226I probably damaging Het
Timeless T G 10: 128,247,608 V702G probably benign Het
Tjp1 A T 7: 65,313,005 S1061R probably benign Het
Tmem39b A T 4: 129,693,218 C67S probably damaging Het
Tstd3 T C 4: 21,759,475 Y99C probably damaging Het
Ttc39c T A 18: 12,684,824 probably null Het
Ttll7 C T 3: 146,894,405 P23S probably benign Het
Uba5 A G 9: 104,049,908 F290S probably damaging Het
Ubap2l T C 3: 90,019,231 Y623C probably damaging Het
Ube3a A G 7: 59,275,966 E164G probably damaging Het
Ugcg A G 4: 59,207,775 N38S probably benign Het
Ugp2 G A 11: 21,329,915 T283I probably damaging Het
Vmn1r55 A T 7: 5,146,920 I168N probably benign Het
Wdr27 A C 17: 14,892,441 S668A probably damaging Het
Wnt2 T A 6: 18,008,697 N247I probably damaging Het
Zfp850 A T 7: 27,985,275 C15* probably null Het
Zfp959 A G 17: 55,897,677 probably null Het
Other mutations in Srpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Srpr APN 9 35213438 missense probably damaging 1.00
IGL01806:Srpr APN 9 35214905 missense possibly damaging 0.90
IGL02581:Srpr APN 9 35215032 critical splice donor site probably null
IGL03002:Srpr APN 9 35214721 missense probably damaging 0.98
IGL03132:Srpr APN 9 35214278 splice site probably null
R0294:Srpr UTSW 9 35215515 missense probably damaging 1.00
R0455:Srpr UTSW 9 35214981 missense probably benign 0.01
R0483:Srpr UTSW 9 35215995 missense possibly damaging 0.95
R0531:Srpr UTSW 9 35213501 missense probably benign
R1112:Srpr UTSW 9 35214959 missense probably benign 0.03
R1507:Srpr UTSW 9 35215470 missense probably benign 0.08
R1970:Srpr UTSW 9 35213538 splice site probably null
R1971:Srpr UTSW 9 35213538 splice site probably null
R2442:Srpr UTSW 9 35212001 missense possibly damaging 0.90
R4475:Srpr UTSW 9 35212859 missense possibly damaging 0.92
R4575:Srpr UTSW 9 35214608 missense possibly damaging 0.92
R4576:Srpr UTSW 9 35214608 missense possibly damaging 0.92
R4578:Srpr UTSW 9 35214608 missense possibly damaging 0.92
R4793:Srpr UTSW 9 35213151 missense probably benign 0.12
R4930:Srpr UTSW 9 35215030 missense probably benign 0.00
R4942:Srpr UTSW 9 35215470 missense probably benign 0.08
R5517:Srpr UTSW 9 35211350 missense probably benign
R6208:Srpr UTSW 9 35215995 missense possibly damaging 0.95
R8340:Srpr UTSW 9 35215806 missense probably damaging 1.00
R8414:Srpr UTSW 9 35214837 missense probably benign 0.08
R8861:Srpr UTSW 9 35215749 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGTGGCGCATCAATATTTACATGG -3'
(R):5'- AACTTGGACCAAACACCTTGGAGAC -3'

Sequencing Primer
(F):5'- TTACATGGGTTCAAACCAGTCAC -3'
(R):5'- TTGGAGACTACAATGCCTCAAG -3'
Posted On2014-05-23