Incidental Mutation 'R1771:Timeless'
ID196609
Institutional Source Beutler Lab
Gene Symbol Timeless
Ensembl Gene ENSMUSG00000039994
Gene Nametimeless circadian clock 1
Synonymstim
MMRRC Submission 039802-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1771 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128232065-128252941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 128247608 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 702 (V702G)
Ref Sequence ENSEMBL: ENSMUSP00000100879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000105242] [ENSMUST00000105243] [ENSMUST00000105244] [ENSMUST00000105245]
Predicted Effect probably benign
Transcript: ENSMUST00000055539
AA Change: V702G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994
AA Change: V702G

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105240
Predicted Effect probably benign
Transcript: ENSMUST00000105242
AA Change: V702G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994
AA Change: V702G

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105243
SMART Domains Protein: ENSMUSP00000100877
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 7.8e-104 PFAM
low complexity region 381 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105244
AA Change: V702G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994
AA Change: V702G

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105245
AA Change: V702G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994
AA Change: V702G

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146945
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is highly conserved and is involved in cell survival after damage or stress, increase in DNA polymerase epsilon activity, maintenance of telomere length, and epithelial cell morphogenesis. The encoded protein also plays a role in the circadian rhythm autoregulatory loop, interacting with the PERIOD genes (PER1, PER2, and PER3) and others to downregulate activation of PER1 by CLOCK/ARNTL. Changes in this gene or its expression may promote prostate cancer, lung cancer, breast cancer, and mental disorders. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit early embryonic lethality at aprroximately the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 106,937,200 S642P probably damaging Het
Adam30 T C 3: 98,161,519 S95P possibly damaging Het
Ahnak G A 19: 9,013,753 V4134I probably benign Het
AI314180 A G 4: 58,879,100 I63T probably damaging Het
Ankrd13a T C 5: 114,803,588 V512A probably benign Het
Asph A T 4: 9,598,773 S149R probably damaging Het
Atp2b4 C A 1: 133,732,393 V384L probably damaging Het
Atp8a1 A G 5: 67,647,731 W1014R probably damaging Het
Cand1 A C 10: 119,208,306 N1054K probably benign Het
Car15 A T 16: 17,836,866 V96E probably damaging Het
Ccdc129 T C 6: 55,898,147 S361P probably benign Het
Cd1d1 T C 3: 86,998,665 E101G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam1 T A 7: 25,472,044 T332S probably benign Het
Clca2 A T 3: 145,081,410 V500E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dennd3 A G 15: 73,555,101 T776A possibly damaging Het
Dennd5a T C 7: 109,918,686 D581G probably damaging Het
Dgkh A G 14: 78,609,527 V371A probably damaging Het
Dhcr24 A G 4: 106,578,253 T314A probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Disp2 C T 2: 118,791,297 Q837* probably null Het
Dusp3 A T 11: 101,984,735 M1K probably null Het
Epp13 G T 7: 6,277,542 probably null Het
Erich3 A C 3: 154,748,472 D625A possibly damaging Het
Fat2 G A 11: 55,310,865 S461L probably benign Het
Fmn2 A G 1: 174,608,776 probably benign Het
Foxi1 A G 11: 34,207,594 Y144H probably damaging Het
Ftcd G A 10: 76,587,368 V458M probably damaging Het
Gm3604 C A 13: 62,370,074 G157* probably null Het
Gnpda1 C T 18: 38,333,327 R79Q probably benign Het
Gpr65 T A 12: 98,276,000 I304K probably damaging Het
Grem1 T C 2: 113,749,676 E160G probably benign Het
Gria2 T A 3: 80,692,301 K759* probably null Het
Gsg1l A G 7: 125,958,573 S128P probably damaging Het
Hdac1 A T 4: 129,521,428 I240N probably damaging Het
Hic2 C T 16: 17,258,714 T469M probably benign Het
Hoxc10 A C 15: 102,967,087 D77A probably damaging Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Klk1b24 A G 7: 44,188,229 probably null Het
Letm1 T A 5: 33,769,467 H162L probably damaging Het
Loxl3 A T 6: 83,049,909 Y573F probably damaging Het
Macf1 A T 4: 123,512,108 I330N probably damaging Het
Mchr1 T A 15: 81,237,235 I62N probably damaging Het
Mcm8 C T 2: 132,843,556 Q803* probably null Het
Msh3 T G 13: 92,212,496 D1075A probably benign Het
Msh6 T A 17: 87,984,522 V235D probably benign Het
Mthfd2l A T 5: 90,974,395 D253V probably damaging Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Muc20 A T 16: 32,793,852 I385N probably damaging Het
Myo6 G T 9: 80,285,800 C829F probably damaging Het
Nbea T C 3: 55,934,519 I1914V probably benign Het
Ncor1 T C 11: 62,327,112 E1462G probably damaging Het
Necab1 A G 4: 15,111,267 Y54H probably damaging Het
Nlrp4b A G 7: 10,718,593 K15R probably damaging Het
Ntrk1 A G 3: 87,789,630 S139P probably benign Het
Oas1d T C 5: 120,915,837 F120S probably damaging Het
Ofd1 A G X: 166,406,006 Y755H probably benign Het
Olfr118 A G 17: 37,672,663 I213M probably damaging Het
Olfr1317 T G 2: 112,142,720 Y258* probably null Het
Olfr1412 A G 1: 92,589,115 I262V probably benign Het
Olfr368 T A 2: 37,332,418 F224I probably benign Het
Olfr482 A C 7: 108,095,609 probably null Het
Olfr539 A G 7: 140,668,135 T276A probably benign Het
Plekha6 T C 1: 133,273,913 S355P probably benign Het
Prdm14 T C 1: 13,118,858 K421E probably damaging Het
Prss36 A G 7: 127,933,453 L731P probably damaging Het
Rad51d A G 11: 82,883,938 L97P probably damaging Het
Rbl1 C A 2: 157,163,534 probably null Het
Rnh1 G T 7: 141,164,606 A52D possibly damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Ryr2 A C 13: 11,745,176 probably null Het
Samd4 A T 14: 47,089,075 N454I probably damaging Het
Sap130 T C 18: 31,636,082 I32T probably benign Het
Sap30l A T 11: 57,806,099 N85I probably damaging Het
Sbf2 G A 7: 110,461,146 Q204* probably null Het
Slc45a3 T C 1: 131,976,956 W6R possibly damaging Het
Snx16 A G 3: 10,419,161 V334A probably damaging Het
Soat1 C T 1: 156,442,421 V143I probably benign Het
Sp8 T A 12: 118,849,567 F386I probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Srpr A T 9: 35,212,851 N31I possibly damaging Het
Ssbp4 A G 8: 70,598,852 probably null Het
Stxbp2 G T 8: 3,634,064 A124S probably benign Het
Tacc2 A G 7: 130,742,240 K700R probably damaging Het
Tatdn2 A T 6: 113,702,099 probably null Het
Tecrl G A 5: 83,291,287 T226I probably damaging Het
Tjp1 A T 7: 65,313,005 S1061R probably benign Het
Tmem39b A T 4: 129,693,218 C67S probably damaging Het
Tstd3 T C 4: 21,759,475 Y99C probably damaging Het
Ttc39c T A 18: 12,684,824 probably null Het
Ttll7 C T 3: 146,894,405 P23S probably benign Het
Uba5 A G 9: 104,049,908 F290S probably damaging Het
Ubap2l T C 3: 90,019,231 Y623C probably damaging Het
Ube3a A G 7: 59,275,966 E164G probably damaging Het
Ugcg A G 4: 59,207,775 N38S probably benign Het
Ugp2 G A 11: 21,329,915 T283I probably damaging Het
Vmn1r55 A T 7: 5,146,920 I168N probably benign Het
Wdr27 A C 17: 14,892,441 S668A probably damaging Het
Wnt2 T A 6: 18,008,697 N247I probably damaging Het
Zfp850 A T 7: 27,985,275 C15* probably null Het
Zfp959 A G 17: 55,897,677 probably null Het
Other mutations in Timeless
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Timeless APN 10 128241708 missense probably damaging 1.00
IGL02157:Timeless APN 10 128242386 missense probably benign 0.01
IGL02300:Timeless APN 10 128244807 missense probably benign 0.00
IGL02587:Timeless APN 10 128239916 missense probably damaging 0.99
IGL02588:Timeless APN 10 128243334 missense probably damaging 1.00
IGL02892:Timeless APN 10 128244251 missense probably damaging 1.00
IGL02930:Timeless APN 10 128247191 missense probably benign 0.00
IGL02986:Timeless APN 10 128249760 missense possibly damaging 0.82
IGL03345:Timeless APN 10 128247586 missense probably benign 0.04
IGL03393:Timeless APN 10 128252055 missense probably damaging 1.00
R0388:Timeless UTSW 10 128241425 splice site probably null
R0607:Timeless UTSW 10 128246334 missense probably benign
R0638:Timeless UTSW 10 128244673 nonsense probably null
R0734:Timeless UTSW 10 128250060 missense probably damaging 1.00
R1346:Timeless UTSW 10 128242365 missense possibly damaging 0.83
R1625:Timeless UTSW 10 128240624 missense probably damaging 0.99
R1860:Timeless UTSW 10 128246114 missense probably benign 0.00
R1920:Timeless UTSW 10 128241714 missense probably damaging 1.00
R1988:Timeless UTSW 10 128244187 missense probably damaging 0.98
R2981:Timeless UTSW 10 128248458 missense probably benign 0.34
R4359:Timeless UTSW 10 128247342 missense probably benign 0.00
R4647:Timeless UTSW 10 128239956 missense possibly damaging 0.80
R4753:Timeless UTSW 10 128240020 utr 5 prime probably benign
R4868:Timeless UTSW 10 128247361 missense probably benign
R4901:Timeless UTSW 10 128250762 missense probably damaging 1.00
R4956:Timeless UTSW 10 128241651 missense probably damaging 1.00
R5341:Timeless UTSW 10 128247178 missense possibly damaging 0.81
R5439:Timeless UTSW 10 128241735 missense probably damaging 1.00
R5585:Timeless UTSW 10 128240243 missense probably damaging 0.97
R5842:Timeless UTSW 10 128247459 critical splice donor site probably null
R5843:Timeless UTSW 10 128244244 splice site probably null
R6005:Timeless UTSW 10 128244200 missense probably damaging 0.99
R6271:Timeless UTSW 10 128250724 missense probably damaging 1.00
R6558:Timeless UTSW 10 128249563 missense probably benign 0.01
R6694:Timeless UTSW 10 128239999 critical splice donor site probably null
R6738:Timeless UTSW 10 128240635 missense probably damaging 1.00
R6760:Timeless UTSW 10 128246117 missense probably benign 0.38
R7213:Timeless UTSW 10 128243289 missense probably benign
R7248:Timeless UTSW 10 128252001 missense probably benign
R7345:Timeless UTSW 10 128249754 missense probably damaging 1.00
R7463:Timeless UTSW 10 128250426 missense probably benign 0.00
R7513:Timeless UTSW 10 128249530 missense probably damaging 0.99
R7574:Timeless UTSW 10 128244669 missense probably damaging 1.00
R8220:Timeless UTSW 10 128246396 missense probably damaging 0.98
X0028:Timeless UTSW 10 128250325 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTCCTGATTGCAACTCCAGTTTCC -3'
(R):5'- GGTCACTAAGCAGCCGATTGAAGAG -3'

Sequencing Primer
(F):5'- agaggaggaagaggaagagg -3'
(R):5'- GCCGATTGAAGAGGCAGAAC -3'
Posted On2014-05-23