Incidental Mutation 'R1771:Or10al2'
ID 196638
Institutional Source Beutler Lab
Gene Symbol Or10al2
Ensembl Gene ENSMUSG00000080990
Gene Name olfactory receptor family 10 subfamily AL member 2
Synonyms GA_x6K02T2PSCP-2131124-2132089, MOR263-13, Olfr118
MMRRC Submission 039802-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R1771 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 37982916-37983888 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37983554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 213 (I213M)
Ref Sequence ENSEMBL: ENSMUSP00000151212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]
AlphaFold Q7TRJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000122036
AA Change: I213M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: I213M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 32 173 2e-6 PFAM
Pfam:7tm_4 37 314 2.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 41 311 5.8e-6 PFAM
Pfam:7tm_1 47 296 1.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215811
AA Change: I213M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216551
AA Change: I213M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 106,773,061 (GRCm39) S642P probably damaging Het
Adam30 T C 3: 98,068,835 (GRCm39) S95P possibly damaging Het
Ahnak G A 19: 8,991,117 (GRCm39) V4134I probably benign Het
Ankrd13a T C 5: 114,941,649 (GRCm39) V512A probably benign Het
Asph A T 4: 9,598,773 (GRCm39) S149R probably damaging Het
Atp2b4 C A 1: 133,660,131 (GRCm39) V384L probably damaging Het
Atp8a1 A G 5: 67,805,074 (GRCm39) W1014R probably damaging Het
Cand1 A C 10: 119,044,211 (GRCm39) N1054K probably benign Het
Car15 A T 16: 17,654,730 (GRCm39) V96E probably damaging Het
Cd1d1 T C 3: 86,905,972 (GRCm39) E101G possibly damaging Het
Cd84 A G 1: 171,700,317 (GRCm39) T145A possibly damaging Het
Ceacam1 T A 7: 25,171,469 (GRCm39) T332S probably benign Het
Clca3a2 A T 3: 144,787,171 (GRCm39) V500E probably benign Het
Cul9 A T 17: 46,848,738 (GRCm39) M666K probably benign Het
Dennd3 A G 15: 73,426,950 (GRCm39) T776A possibly damaging Het
Dennd5a T C 7: 109,517,893 (GRCm39) D581G probably damaging Het
Dgkh A G 14: 78,846,967 (GRCm39) V371A probably damaging Het
Dhcr24 A G 4: 106,435,450 (GRCm39) T314A probably benign Het
Diaph1 G T 18: 38,024,071 (GRCm39) P589Q unknown Het
Disp2 C T 2: 118,621,778 (GRCm39) Q837* probably null Het
Dusp3 A T 11: 101,875,561 (GRCm39) M1K probably null Het
Ecpas A G 4: 58,879,100 (GRCm39) I63T probably damaging Het
Eddm13 G T 7: 6,280,541 (GRCm39) probably null Het
Erich3 A C 3: 154,454,109 (GRCm39) D625A possibly damaging Het
Fat2 G A 11: 55,201,691 (GRCm39) S461L probably benign Het
Fmn2 A G 1: 174,436,342 (GRCm39) probably benign Het
Foxi1 A G 11: 34,157,594 (GRCm39) Y144H probably damaging Het
Ftcd G A 10: 76,423,202 (GRCm39) V458M probably damaging Het
Gm3604 C A 13: 62,517,888 (GRCm39) G157* probably null Het
Gnpda1 C T 18: 38,466,380 (GRCm39) R79Q probably benign Het
Gpr65 T A 12: 98,242,259 (GRCm39) I304K probably damaging Het
Grem1 T C 2: 113,580,021 (GRCm39) E160G probably benign Het
Gria2 T A 3: 80,599,608 (GRCm39) K759* probably null Het
Gsg1l A G 7: 125,557,745 (GRCm39) S128P probably damaging Het
Hdac1 A T 4: 129,415,221 (GRCm39) I240N probably damaging Het
Hic2 C T 16: 17,076,578 (GRCm39) T469M probably benign Het
Hoxc10 A C 15: 102,875,522 (GRCm39) D77A probably damaging Het
Itprid1 T C 6: 55,875,132 (GRCm39) S361P probably benign Het
Klhl14 T A 18: 21,784,677 (GRCm39) H250L probably damaging Het
Klk1b24 A G 7: 43,837,653 (GRCm39) probably null Het
Letm1 T A 5: 33,926,811 (GRCm39) H162L probably damaging Het
Loxl3 A T 6: 83,026,890 (GRCm39) Y573F probably damaging Het
Macf1 A T 4: 123,405,901 (GRCm39) I330N probably damaging Het
Mchr1 T A 15: 81,121,436 (GRCm39) I62N probably damaging Het
Mcm8 C T 2: 132,685,476 (GRCm39) Q803* probably null Het
Msh3 T G 13: 92,349,004 (GRCm39) D1075A probably benign Het
Msh6 T A 17: 88,291,950 (GRCm39) V235D probably benign Het
Mthfd2l A T 5: 91,122,254 (GRCm39) D253V probably damaging Het
Mtor T C 4: 148,555,081 (GRCm39) V901A possibly damaging Het
Muc20 A T 16: 32,614,222 (GRCm39) I385N probably damaging Het
Myo6 G T 9: 80,193,082 (GRCm39) C829F probably damaging Het
Nbea T C 3: 55,841,940 (GRCm39) I1914V probably benign Het
Ncor1 T C 11: 62,217,938 (GRCm39) E1462G probably damaging Het
Necab1 A G 4: 15,111,267 (GRCm39) Y54H probably damaging Het
Nlrp4b A G 7: 10,452,520 (GRCm39) K15R probably damaging Het
Ntrk1 A G 3: 87,696,937 (GRCm39) S139P probably benign Het
Oas1d T C 5: 121,053,900 (GRCm39) F120S probably damaging Het
Ofd1 A G X: 165,189,002 (GRCm39) Y755H probably benign Het
Or13a25 A G 7: 140,248,048 (GRCm39) T276A probably benign Het
Or4f47 T G 2: 111,973,065 (GRCm39) Y258* probably null Het
Or5c1 T A 2: 37,222,430 (GRCm39) F224I probably benign Het
Or5p58 A C 7: 107,694,816 (GRCm39) probably null Het
Or9s27 A G 1: 92,516,837 (GRCm39) I262V probably benign Het
Plekha6 T C 1: 133,201,651 (GRCm39) S355P probably benign Het
Prdm14 T C 1: 13,189,082 (GRCm39) K421E probably damaging Het
Prss36 A G 7: 127,532,625 (GRCm39) L731P probably damaging Het
Rad51d A G 11: 82,774,764 (GRCm39) L97P probably damaging Het
Rbl1 C A 2: 157,005,454 (GRCm39) probably null Het
Rnh1 G T 7: 140,744,519 (GRCm39) A52D possibly damaging Het
Rps24 A G 14: 24,541,830 (GRCm39) T6A probably damaging Het
Ryr2 A C 13: 11,760,062 (GRCm39) probably null Het
Samd4 A T 14: 47,326,532 (GRCm39) N454I probably damaging Het
Sap130 T C 18: 31,769,135 (GRCm39) I32T probably benign Het
Sap30l A T 11: 57,696,925 (GRCm39) N85I probably damaging Het
Sbf2 G A 7: 110,060,353 (GRCm39) Q204* probably null Het
Slc45a3 T C 1: 131,904,694 (GRCm39) W6R possibly damaging Het
Snx16 A G 3: 10,484,221 (GRCm39) V334A probably damaging Het
Soat1 C T 1: 156,269,991 (GRCm39) V143I probably benign Het
Sp8 T A 12: 118,813,302 (GRCm39) F386I probably damaging Het
Spag6 C T 2: 18,738,928 (GRCm39) S286L probably benign Het
Srpra A T 9: 35,124,147 (GRCm39) N31I possibly damaging Het
Ssbp4 A G 8: 71,051,502 (GRCm39) probably null Het
Stxbp2 G T 8: 3,684,064 (GRCm39) A124S probably benign Het
Tacc2 A G 7: 130,343,970 (GRCm39) K700R probably damaging Het
Tatdn2 A T 6: 113,679,060 (GRCm39) probably null Het
Tecrl G A 5: 83,439,134 (GRCm39) T226I probably damaging Het
Timeless T G 10: 128,083,477 (GRCm39) V702G probably benign Het
Tjp1 A T 7: 64,962,753 (GRCm39) S1061R probably benign Het
Tmem39b A T 4: 129,587,011 (GRCm39) C67S probably damaging Het
Tstd3 T C 4: 21,759,475 (GRCm39) Y99C probably damaging Het
Ttc39c T A 18: 12,817,881 (GRCm39) probably null Het
Ttll7 C T 3: 146,600,160 (GRCm39) P23S probably benign Het
Uba5 A G 9: 103,927,107 (GRCm39) F290S probably damaging Het
Ubap2l T C 3: 89,926,538 (GRCm39) Y623C probably damaging Het
Ube3a A G 7: 58,925,714 (GRCm39) E164G probably damaging Het
Ugcg A G 4: 59,207,775 (GRCm39) N38S probably benign Het
Ugp2 G A 11: 21,279,915 (GRCm39) T283I probably damaging Het
Vmn1r55 A T 7: 5,149,919 (GRCm39) I168N probably benign Het
Wdr27 A C 17: 15,112,703 (GRCm39) S668A probably damaging Het
Wnt2 T A 6: 18,008,696 (GRCm39) N247I probably damaging Het
Zfp850 A T 7: 27,684,700 (GRCm39) C15* probably null Het
Zfp959 A G 17: 56,204,677 (GRCm39) probably null Het
Other mutations in Or10al2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Or10al2 APN 17 37,983,778 (GRCm39) missense probably damaging 1.00
IGL02456:Or10al2 APN 17 37,983,340 (GRCm39) missense possibly damaging 0.90
IGL02750:Or10al2 APN 17 37,983,500 (GRCm39) nonsense probably null
IGL03083:Or10al2 APN 17 37,983,551 (GRCm39) nonsense probably null
IGL03339:Or10al2 APN 17 37,983,448 (GRCm39) missense possibly damaging 0.87
R0032:Or10al2 UTSW 17 37,983,378 (GRCm39) missense probably damaging 1.00
R1457:Or10al2 UTSW 17 37,983,816 (GRCm39) nonsense probably null
R1542:Or10al2 UTSW 17 37,983,142 (GRCm39) missense probably damaging 1.00
R1893:Or10al2 UTSW 17 37,983,747 (GRCm39) nonsense probably null
R2395:Or10al2 UTSW 17 37,983,587 (GRCm39) nonsense probably null
R3619:Or10al2 UTSW 17 37,983,531 (GRCm39) missense probably benign 0.05
R3917:Or10al2 UTSW 17 37,983,684 (GRCm39) missense probably damaging 1.00
R3937:Or10al2 UTSW 17 37,983,858 (GRCm39) missense probably benign 0.01
R5600:Or10al2 UTSW 17 37,983,176 (GRCm39) missense possibly damaging 0.91
R6415:Or10al2 UTSW 17 37,983,448 (GRCm39) missense possibly damaging 0.87
R6462:Or10al2 UTSW 17 37,983,111 (GRCm39) missense probably damaging 1.00
R7355:Or10al2 UTSW 17 37,983,301 (GRCm39) missense probably benign 0.02
R7861:Or10al2 UTSW 17 37,983,408 (GRCm39) missense possibly damaging 0.91
R7913:Or10al2 UTSW 17 37,982,999 (GRCm39) missense probably benign
R7952:Or10al2 UTSW 17 37,983,708 (GRCm39) missense probably damaging 1.00
R7969:Or10al2 UTSW 17 37,983,547 (GRCm39) missense probably damaging 1.00
R8879:Or10al2 UTSW 17 37,983,302 (GRCm39) nonsense probably null
R8923:Or10al2 UTSW 17 37,983,702 (GRCm39) missense probably benign 0.00
R9253:Or10al2 UTSW 17 37,983,637 (GRCm39) missense probably benign 0.00
R9778:Or10al2 UTSW 17 37,983,145 (GRCm39) missense probably damaging 0.97
R9789:Or10al2 UTSW 17 37,983,059 (GRCm39) missense probably damaging 1.00
RF003:Or10al2 UTSW 17 37,983,749 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCCTTTGACCGCTACATGG -3'
(R):5'- ATGGGGTTCAGCATGGATGTCAC -3'

Sequencing Primer
(F):5'- TTACTCAACCCGAATGAGTCGTG -3'
(R):5'- AGGGCCAAGAGTTTGTCCATTC -3'
Posted On 2014-05-23