Incidental Mutation 'R1772:Szt2'
ID 196677
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 039803-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R1772 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118262714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 21 (K21M)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019229] [ENSMUST00000073881] [ENSMUST00000075406] [ENSMUST00000084319] [ENSMUST00000106384] [ENSMUST00000126089] [ENSMUST00000144577]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019229
SMART Domains Protein: ENSMUSP00000019229
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 1 265 1.2e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073881
SMART Domains Protein: ENSMUSP00000073544
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 2 129 1.4e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075406
AA Change: K21M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: K21M

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084319
SMART Domains Protein: ENSMUSP00000081346
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 2 179 1.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106384
SMART Domains Protein: ENSMUSP00000101992
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 1 234 3.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130421
Predicted Effect probably benign
Transcript: ENSMUST00000144577
SMART Domains Protein: ENSMUSP00000120158
Gene: ENSMUSG00000006392

DomainStartEndE-ValueType
Pfam:Med8 2 75 3.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152633
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,258,465 (GRCm39) probably benign Het
Aldh1a7 T C 19: 20,693,383 (GRCm39) K179E probably damaging Het
Angptl7 G A 4: 148,581,883 (GRCm39) R168C probably damaging Het
Atp8b1 T A 18: 64,706,563 (GRCm39) I208F possibly damaging Het
Bco1 A G 8: 117,857,347 (GRCm39) Y438C probably benign Het
Bltp1 T C 3: 37,013,581 (GRCm39) S1937P probably damaging Het
Btrc A C 19: 45,501,100 (GRCm39) K218Q probably damaging Het
Cct8l1 G A 5: 25,722,697 (GRCm39) V471M probably damaging Het
Cd180 C T 13: 102,842,750 (GRCm39) L599F probably benign Het
Cd300e T C 11: 114,945,344 (GRCm39) N150S probably benign Het
Clcn1 C A 6: 42,271,079 (GRCm39) T281K probably damaging Het
Cnnm3 T C 1: 36,558,038 (GRCm39) S417P probably damaging Het
Cspg4 T A 9: 56,804,776 (GRCm39) S1862R probably benign Het
Cspg5 A T 9: 110,091,206 (GRCm39) N432Y probably damaging Het
Cyp2r1 T A 7: 114,152,451 (GRCm39) I169F probably damaging Het
D130043K22Rik T A 13: 25,059,982 (GRCm39) S618T probably damaging Het
Diaph3 G A 14: 87,202,985 (GRCm39) P635L probably damaging Het
Dlg1 A G 16: 31,484,485 (GRCm39) I38V possibly damaging Het
Dlk1 T G 12: 109,425,685 (GRCm39) V186G probably damaging Het
Dmxl2 T C 9: 54,330,508 (GRCm39) probably benign Het
Dnajc17 G A 2: 119,014,164 (GRCm39) R132* probably null Het
Dock9 G T 14: 121,847,210 (GRCm39) N1042K probably benign Het
Dok7 A T 5: 35,243,994 (GRCm39) Q511L probably damaging Het
Espnl G A 1: 91,272,325 (GRCm39) E562K possibly damaging Het
Evi5 G A 5: 107,943,707 (GRCm39) T562I probably benign Het
Exd2 T A 12: 80,536,253 (GRCm39) D294E probably benign Het
Fbn1 A T 2: 125,245,148 (GRCm39) D246E possibly damaging Het
Fbxw16 A T 9: 109,268,650 (GRCm39) W247R possibly damaging Het
Fcer1a A G 1: 173,053,004 (GRCm39) I64T probably benign Het
Fcgbp C A 7: 27,804,600 (GRCm39) Q1903K possibly damaging Het
Fmn1 A G 2: 113,195,700 (GRCm39) S467G unknown Het
Fndc7 T A 3: 108,777,850 (GRCm39) T369S probably damaging Het
Fnta T C 8: 26,490,994 (GRCm39) probably benign Het
Gak A T 5: 108,754,758 (GRCm39) H289Q probably damaging Het
Gas2l3 A G 10: 89,252,876 (GRCm39) probably benign Het
Gbp8 T C 5: 105,163,987 (GRCm39) N437S probably benign Het
Gk5 G A 9: 96,032,850 (GRCm39) probably null Het
Hid1 A T 11: 115,239,299 (GRCm39) V788E probably damaging Het
Hmcn1 T C 1: 150,439,319 (GRCm39) T5505A probably damaging Het
Igf1r T A 7: 67,844,822 (GRCm39) M865K probably benign Het
Katnal2 G A 18: 77,090,233 (GRCm39) T258I probably damaging Het
Kdm3b A T 18: 34,936,557 (GRCm39) I280L probably benign Het
Kif24 A G 4: 41,409,787 (GRCm39) V382A probably damaging Het
Kif2a A T 13: 107,114,640 (GRCm39) probably benign Het
Klhl10 A G 11: 100,333,022 (GRCm39) I56V probably benign Het
Klk6 C T 7: 43,478,695 (GRCm39) Q201* probably null Het
Klra3 A T 6: 130,300,671 (GRCm39) S233T probably benign Het
Krt9 A T 11: 100,082,131 (GRCm39) M223K probably damaging Het
Lama4 G A 10: 38,936,220 (GRCm39) E632K probably benign Het
Lamb1 T C 12: 31,328,524 (GRCm39) Y163H probably damaging Het
Lipo3 A G 19: 33,764,821 (GRCm39) I11T probably benign Het
Lix1l T A 3: 96,531,207 (GRCm39) H333Q possibly damaging Het
Mal2 T A 15: 54,451,783 (GRCm39) M68K probably damaging Het
Map2k2 T C 10: 80,956,934 (GRCm39) I104T probably damaging Het
Matn2 T C 15: 34,428,931 (GRCm39) V765A probably damaging Het
Mptx2 T A 1: 173,102,040 (GRCm39) K216N probably damaging Het
Mup5 C T 4: 61,750,578 (GRCm39) probably null Het
Mycbp2 A G 14: 103,419,855 (GRCm39) Y2494H probably damaging Het
Myh3 G A 11: 66,990,220 (GRCm39) D1622N probably benign Het
Myo6 T C 9: 80,177,331 (GRCm39) I609T possibly damaging Het
Ndst1 G A 18: 60,835,909 (GRCm39) T458I probably damaging Het
Neb A T 2: 52,125,689 (GRCm39) Y3622N probably damaging Het
Ntm A G 9: 29,090,396 (GRCm39) Y108H probably benign Het
Or13c3 T G 4: 52,855,730 (GRCm39) K261T probably benign Het
Or1a1b T C 11: 74,097,398 (GRCm39) I215V probably benign Het
Or52e19 T C 7: 102,959,449 (GRCm39) Y174H possibly damaging Het
Pappa2 T A 1: 158,641,938 (GRCm39) I1373F possibly damaging Het
Pear1 A G 3: 87,661,799 (GRCm39) probably benign Het
Phc3 C T 3: 31,015,969 (GRCm39) A81T probably damaging Het
Pmepa1 A G 2: 173,076,153 (GRCm39) S105P probably damaging Het
Ppp6r1 T C 7: 4,645,030 (GRCm39) I248V probably benign Het
Prdm4 G A 10: 85,729,256 (GRCm39) T717I probably damaging Het
Prom1 T C 5: 44,168,566 (GRCm39) T669A probably benign Het
Ptpn5 T A 7: 46,740,516 (GRCm39) I96F probably benign Het
Ptpro T C 6: 137,407,741 (GRCm39) L922P probably damaging Het
Reck A T 4: 43,890,982 (GRCm39) H40L probably benign Het
Rreb1 T A 13: 38,114,899 (GRCm39) C753S probably benign Het
Sacs T C 14: 61,448,346 (GRCm39) L3464P probably damaging Het
Samsn1 A T 16: 75,667,663 (GRCm39) D304E probably benign Het
Scgb2b3 T C 7: 31,059,621 (GRCm39) N51S possibly damaging Het
Shroom3 T C 5: 93,088,515 (GRCm39) S341P probably damaging Het
Siglece T C 7: 43,308,717 (GRCm39) D212G probably damaging Het
Sirpa A G 2: 129,458,376 (GRCm39) T331A probably damaging Het
Spata21 T C 4: 140,838,607 (GRCm39) S553P possibly damaging Het
Speer4b T A 5: 27,705,236 (GRCm39) probably benign Het
Srgap2 T C 1: 131,247,376 (GRCm39) D552G probably damaging Het
Stab2 A G 10: 86,790,098 (GRCm39) I556T probably benign Het
Strip1 C T 3: 107,534,047 (GRCm39) probably null Het
Stxbp6 T A 12: 44,949,653 (GRCm39) D92V probably damaging Het
Styx A G 14: 45,594,215 (GRCm39) K46E probably damaging Het
Supt20 T A 3: 54,617,841 (GRCm39) V314E probably damaging Het
Syne2 T A 12: 75,985,503 (GRCm39) D1650E probably benign Het
Tbx4 A T 11: 85,802,033 (GRCm39) H222L probably damaging Het
Tcstv1b T A 13: 120,634,725 (GRCm39) D2E probably benign Het
Tmx3 A T 18: 90,551,121 (GRCm39) I254L probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpv2 A T 11: 62,485,052 (GRCm39) probably benign Het
Ubap2 A G 4: 41,202,380 (GRCm39) S683P probably benign Het
Ube2d3 C T 3: 135,170,972 (GRCm39) R139W probably benign Het
Ubox5 G T 2: 130,433,794 (GRCm39) Q518K probably benign Het
Usp42 T C 5: 143,702,857 (GRCm39) N588S probably damaging Het
Vars2 G A 17: 35,970,976 (GRCm39) T618M probably damaging Het
Wfdc17 A T 11: 83,595,730 (GRCm39) N65Y probably damaging Het
Zbtb38 G A 9: 96,570,094 (GRCm39) P330L probably damaging Het
Zfp385a C T 15: 103,224,308 (GRCm39) probably null Het
Zfp637 T A 6: 117,822,373 (GRCm39) L167H probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAAGAGAGGTCCTACTGGGCCAGG -3'
(R):5'- GAAACGTGCTGCAAGATTGTAAGTTCC -3'

Sequencing Primer
(F):5'- GGCCAGGCCCTCACTTC -3'
(R):5'- agttcagttcccagcaacc -3'
Posted On 2014-05-23