Mutagenetix > Incidental Mutation

Incidental Mutation 'R1772:Shroom3'

196685

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

039803-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1772 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92940656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 341 (S341P)

Ref Sequence

ENSEMBL: ENSMUSP00000153516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000113051
AA Change: S247P

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: S247P

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113054
AA Change: S247P

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: S247P

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113055
AA Change: S422P

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: S422P

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168878
AA Change: S422P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: S422P

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172706

SMART Domains

Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201800

Predicted Effect

probably damaging
Transcript: ENSMUST00000225438
AA Change: S341P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

Meta Mutation Damage Score

0.0774

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.5%

Validation Efficiency

97% (107/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,959,432	S1937P	probably damaging	Het
Adgb	G	T	10: 10,382,721		probably benign	Het
Aldh1a7	T	C	19: 20,716,019	K179E	probably damaging	Het
Angptl7	G	A	4: 148,497,426	R168C	probably damaging	Het
Atp8b1	T	A	18: 64,573,492	I208F	possibly damaging	Het
Bco1	A	G	8: 117,130,608	Y438C	probably benign	Het
Btrc	A	C	19: 45,512,661	K218Q	probably damaging	Het
Cct8l1	G	A	5: 25,517,699	V471M	probably damaging	Het
Cd180	C	T	13: 102,706,242	L599F	probably benign	Het
Cd300e	T	C	11: 115,054,518	N150S	probably benign	Het
Clcn1	C	A	6: 42,294,145	T281K	probably damaging	Het
Cnnm3	T	C	1: 36,518,957	S417P	probably damaging	Het
Cspg4	T	A	9: 56,897,492	S1862R	probably benign	Het
Cspg5	A	T	9: 110,262,138	N432Y	probably damaging	Het
Cyp2r1	T	A	7: 114,553,216	I169F	probably damaging	Het
D130043K22Rik	T	A	13: 24,875,999	S618T	probably damaging	Het
Diaph3	G	A	14: 86,965,549	P635L	probably damaging	Het
Dlg1	A	G	16: 31,665,667	I38V	possibly damaging	Het
Dlk1	T	G	12: 109,459,759	V186G	probably damaging	Het
Dmxl2	T	C	9: 54,423,224		probably benign	Het
Dnajc17	G	A	2: 119,183,683	R132*	probably null	Het
Dock9	G	T	14: 121,609,798	N1042K	probably benign	Het
Dok7	A	T	5: 35,086,650	Q511L	probably damaging	Het
Espnl	G	A	1: 91,344,603	E562K	possibly damaging	Het
Evi5	G	A	5: 107,795,841	T562I	probably benign	Het
Exd2	T	A	12: 80,489,479	D294E	probably benign	Het
Fbn1	A	T	2: 125,403,228	D246E	possibly damaging	Het
Fbxw16	A	T	9: 109,439,582	W247R	possibly damaging	Het
Fcer1a	A	G	1: 173,225,437	I64T	probably benign	Het
Fcgbp	C	A	7: 28,105,175	Q1903K	possibly damaging	Het
Fmn1	A	G	2: 113,365,355	S467G	unknown	Het
Fndc7	T	A	3: 108,870,534	T369S	probably damaging	Het
Fnta	T	C	8: 26,000,966		probably benign	Het
Gak	A	T	5: 108,606,892	H289Q	probably damaging	Het
Gas2l3	A	G	10: 89,417,014		probably benign	Het
Gbp8	T	C	5: 105,016,121	N437S	probably benign	Het
Gk5	G	A	9: 96,150,797		probably null	Het
Gm21818	T	A	13: 120,173,189	D2E	probably benign	Het
Hid1	A	T	11: 115,348,473	V788E	probably damaging	Het
Hmcn1	T	C	1: 150,563,568	T5505A	probably damaging	Het
Igf1r	T	A	7: 68,195,074	M865K	probably benign	Het
Katnal2	G	A	18: 77,002,537	T258I	probably damaging	Het
Kdm3b	A	T	18: 34,803,504	I280L	probably benign	Het
Kif24	A	G	4: 41,409,787	V382A	probably damaging	Het
Kif2a	A	T	13: 106,978,132		probably benign	Het
Klhl10	A	G	11: 100,442,196	I56V	probably benign	Het
Klk6	C	T	7: 43,829,271	Q201*	probably null	Het
Klra3	A	T	6: 130,323,708	S233T	probably benign	Het
Krt9	A	T	11: 100,191,305	M223K	probably damaging	Het
Lama4	G	A	10: 39,060,224	E632K	probably benign	Het
Lamb1	T	C	12: 31,278,525	Y163H	probably damaging	Het
Lipo1	A	G	19: 33,787,421	I11T	probably benign	Het
Lix1l	T	A	3: 96,623,891	H333Q	possibly damaging	Het
Mal2	T	A	15: 54,588,387	M68K	probably damaging	Het
Map2k2	T	C	10: 81,121,100	I104T	probably damaging	Het
Matn2	T	C	15: 34,428,785	V765A	probably damaging	Het
Mptx2	T	A	1: 173,274,473	K216N	probably damaging	Het
Mup5	C	T	4: 61,832,341		probably null	Het
Mycbp2	A	G	14: 103,182,419	Y2494H	probably damaging	Het
Myh3	G	A	11: 67,099,394	D1622N	probably benign	Het
Myo6	T	C	9: 80,270,049	I609T	possibly damaging	Het
Ndst1	G	A	18: 60,702,837	T458I	probably damaging	Het
Neb	A	T	2: 52,235,677	Y3622N	probably damaging	Het
Ntm	A	G	9: 29,179,100	Y108H	probably benign	Het
Olfr273	T	G	4: 52,855,730	K261T	probably benign	Het
Olfr43	T	C	11: 74,206,572	I215V	probably benign	Het
Olfr596	T	C	7: 103,310,242	Y174H	possibly damaging	Het
Pappa2	T	A	1: 158,814,368	I1373F	possibly damaging	Het
Pear1	A	G	3: 87,754,492		probably benign	Het
Phc3	C	T	3: 30,961,820	A81T	probably damaging	Het
Pmepa1	A	G	2: 173,234,360	S105P	probably damaging	Het
Ppp6r1	T	C	7: 4,642,031	I248V	probably benign	Het
Prdm4	G	A	10: 85,893,392	T717I	probably damaging	Het
Prom1	T	C	5: 44,011,224	T669A	probably benign	Het
Ptpn5	T	A	7: 47,090,768	I96F	probably benign	Het
Ptpro	T	C	6: 137,430,743	L922P	probably damaging	Het
Reck	A	T	4: 43,890,982	H40L	probably benign	Het
Rreb1	T	A	13: 37,930,923	C753S	probably benign	Het
Sacs	T	C	14: 61,210,897	L3464P	probably damaging	Het
Samsn1	A	T	16: 75,870,775	D304E	probably benign	Het
Scgb2b3	T	C	7: 31,360,196	N51S	possibly damaging	Het
Siglece	T	C	7: 43,659,293	D212G	probably damaging	Het
Sirpa	A	G	2: 129,616,456	T331A	probably damaging	Het
Spata21	T	C	4: 141,111,296	S553P	possibly damaging	Het
Speer4b	T	A	5: 27,500,238		probably benign	Het
Srgap2	T	C	1: 131,319,638	D552G	probably damaging	Het
Stab2	A	G	10: 86,954,234	I556T	probably benign	Het
Strip1	C	T	3: 107,626,731		probably null	Het
Stxbp6	T	A	12: 44,902,870	D92V	probably damaging	Het
Styx	A	G	14: 45,356,758	K46E	probably damaging	Het
Supt20	T	A	3: 54,710,420	V314E	probably damaging	Het
Syne2	T	A	12: 75,938,729	D1650E	probably benign	Het
Szt2	T	A	4: 118,405,517	K21M	probably damaging	Het
Tbx4	A	T	11: 85,911,207	H222L	probably damaging	Het
Tmx3	A	T	18: 90,532,997	I254L	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpv2	A	T	11: 62,594,226		probably benign	Het
Ubap2	A	G	4: 41,202,380	S683P	probably benign	Het
Ube2d3	C	T	3: 135,465,211	R139W	probably benign	Het
Ubox5	G	T	2: 130,591,874	Q518K	probably benign	Het
Usp42	T	C	5: 143,717,102	N588S	probably damaging	Het
Vars2	G	A	17: 35,660,084	T618M	probably damaging	Het
Wfdc17	A	T	11: 83,704,904	N65Y	probably damaging	Het
Zbtb38	G	A	9: 96,688,041	P330L	probably damaging	Het
Zfp385a	C	T	15: 103,315,881		probably null	Het
Zfp637	T	A	6: 117,845,412	L167H	probably damaging	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCCTGGAGACTGCTACTGACAAC -3'
(R):5'- GCCATCTTGTTACAGGTTCCCTGAG -3'

Sequencing Primer
(F):5'- TGCTACTGACAACCTGCC -3'
(R):5'- GTGCCATTACTACTCACAGAGGG -3'

Posted On

2014-05-23