Incidental Mutation 'R0081:Foxp2'
List |< first << previous [record 20 of 75] next >> last >|
ID19670
Institutional Source Beutler Lab
Gene Symbol Foxp2
Ensembl Gene ENSMUSG00000029563
Gene Nameforkhead box P2
SynonymsD0Kist7, 2810043D05Rik
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0081 (G1)
Quality Score216
Status Validated
Chromosome6
Chromosomal Location14901349-15441977 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to C at 15405644 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031545] [ENSMUST00000115469] [ENSMUST00000115472] [ENSMUST00000115474] [ENSMUST00000115475] [ENSMUST00000115477] [ENSMUST00000131414]
Predicted Effect probably benign
Transcript: ENSMUST00000031545
SMART Domains Protein: ENSMUSP00000031545
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 140 215 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
ZnF_C2H2 345 370 3.02e0 SMART
low complexity region 437 458 N/A INTRINSIC
FH 501 582 7.5e-37 SMART
low complexity region 605 624 N/A INTRINSIC
low complexity region 697 714 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115469
AA Change: V421A
SMART Domains Protein: ENSMUSP00000111129
Gene: ENSMUSG00000029563
AA Change: V421A

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 48 68 N/A INTRINSIC
coiled coil region 139 214 N/A INTRINSIC
low complexity region 290 303 N/A INTRINSIC
ZnF_C2H2 344 369 3.02e0 SMART
low complexity region 411 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115472
SMART Domains Protein: ENSMUSP00000111132
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 116 194 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
ZnF_C2H2 324 349 3.02e0 SMART
low complexity region 416 437 N/A INTRINSIC
FH 480 561 7.5e-37 SMART
low complexity region 584 603 N/A INTRINSIC
low complexity region 676 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115474
SMART Domains Protein: ENSMUSP00000111134
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 165 240 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
ZnF_C2H2 370 395 3.02e0 SMART
low complexity region 462 483 N/A INTRINSIC
FH 526 607 7.5e-37 SMART
low complexity region 630 649 N/A INTRINSIC
low complexity region 722 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115475
SMART Domains Protein: ENSMUSP00000111135
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 8 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115477
SMART Domains Protein: ENSMUSP00000111137
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 140 215 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
ZnF_C2H2 345 370 3.02e0 SMART
low complexity region 437 458 N/A INTRINSIC
FH 501 582 7.5e-37 SMART
low complexity region 605 624 N/A INTRINSIC
low complexity region 697 714 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131414
AA Change: V447A
SMART Domains Protein: ENSMUSP00000123007
Gene: ENSMUSG00000029563
AA Change: V447A

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 165 240 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
ZnF_C2H2 370 395 3.02e0 SMART
low complexity region 437 446 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175576
Meta Mutation Damage Score 0.1051 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, growth retardation, reduced vocalization, prolonged external granule cell layer presence, abnormal Purkinje and radial glial cells, delayed eye opening and ear emergence, negative geotaxis, impaired righting response, and hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Ddx41 A T 13: 55,535,380 H171Q possibly damaging Het
Dennd5b G T 6: 148,993,759 Q1258K probably benign Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Frmd4a T C 2: 4,572,441 probably null Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
H1foo A G 6: 115,949,981 E273G probably benign Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Hk2 A T 6: 82,734,976 probably benign Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Il10ra T G 9: 45,255,949 M435L probably benign Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr344 T A 2: 36,568,881 Y94* probably null Het
Olfr352 T C 2: 36,870,010 L148S possibly damaging Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Foxp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Foxp2 APN 6 15403819 missense probably damaging 1.00
IGL01011:Foxp2 APN 6 15438019 makesense probably null
IGL01412:Foxp2 APN 6 15376758 intron probably benign
IGL01769:Foxp2 APN 6 15409835 missense possibly damaging 0.92
IGL02578:Foxp2 APN 6 15376815 intron probably benign
IGL03368:Foxp2 APN 6 15394718 missense probably damaging 1.00
R0004:Foxp2 UTSW 6 15197096 missense possibly damaging 0.68
R0095:Foxp2 UTSW 6 15196977 missense probably damaging 1.00
R0233:Foxp2 UTSW 6 15409753 missense probably damaging 1.00
R0294:Foxp2 UTSW 6 15376774 intron probably benign
R0357:Foxp2 UTSW 6 15409840 missense probably damaging 0.99
R0432:Foxp2 UTSW 6 15254279 intron probably benign
R0659:Foxp2 UTSW 6 15254279 intron probably benign
R1381:Foxp2 UTSW 6 15409766 missense possibly damaging 0.50
R1813:Foxp2 UTSW 6 15379768 utr 3 prime probably benign
R1896:Foxp2 UTSW 6 15379768 utr 3 prime probably benign
R2007:Foxp2 UTSW 6 15396819 missense probably damaging 1.00
R2020:Foxp2 UTSW 6 15324644 missense possibly damaging 0.73
R2167:Foxp2 UTSW 6 15437902 missense probably damaging 1.00
R2326:Foxp2 UTSW 6 15409939 missense possibly damaging 0.84
R3829:Foxp2 UTSW 6 15379831 unclassified probably benign
R3978:Foxp2 UTSW 6 15197208 unclassified probably benign
R4393:Foxp2 UTSW 6 15377690 intron probably benign
R4703:Foxp2 UTSW 6 15411248 missense probably benign 0.03
R5202:Foxp2 UTSW 6 15394771 missense probably benign 0.05
R5303:Foxp2 UTSW 6 15324637 missense probably benign 0.00
R5368:Foxp2 UTSW 6 15377914 intron probably benign
R5533:Foxp2 UTSW 6 15197120 nonsense probably null
R5655:Foxp2 UTSW 6 15197113 missense probably damaging 0.99
R6220:Foxp2 UTSW 6 15437948 missense probably damaging 1.00
R6241:Foxp2 UTSW 6 15394762 missense probably damaging 1.00
R6365:Foxp2 UTSW 6 15286685 missense probably damaging 1.00
R6384:Foxp2 UTSW 6 15437948 missense probably damaging 1.00
R7217:Foxp2 UTSW 6 15416024 missense unknown
R7553:Foxp2 UTSW 6 15437882 missense unknown
R7881:Foxp2 UTSW 6 15409889 missense unknown
R7964:Foxp2 UTSW 6 15409889 missense unknown
X0023:Foxp2 UTSW 6 15409835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGCACTTCGCTTTGAGAAC -3'
(R):5'- GTCACCCACAGTGTAGATTGGATGG -3'

Sequencing Primer
(F):5'- TTGCTAACAGTGTCCACAGG -3'
(R):5'- CCACAGTGTAGATTGGATGGATTTTG -3'
Posted On2013-04-11