Mutagenetix > Incidental Mutation

Incidental Mutation 'R1772:Igf1r'

196701

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

line 186, A330103N21Rik, CD221, hyft, IGF-1R

MMRRC Submission

039803-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1772 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67952827-68233668 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 68195074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 865 (M865K)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005671
AA Change: M865K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: M865K

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208348

Meta Mutation Damage Score

0.2147

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.5%

Validation Efficiency

97% (107/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,959,432	S1937P	probably damaging	Het
Adgb	G	T	10: 10,382,721		probably benign	Het
Aldh1a7	T	C	19: 20,716,019	K179E	probably damaging	Het
Angptl7	G	A	4: 148,497,426	R168C	probably damaging	Het
Atp8b1	T	A	18: 64,573,492	I208F	possibly damaging	Het
Bco1	A	G	8: 117,130,608	Y438C	probably benign	Het
Btrc	A	C	19: 45,512,661	K218Q	probably damaging	Het
Cct8l1	G	A	5: 25,517,699	V471M	probably damaging	Het
Cd180	C	T	13: 102,706,242	L599F	probably benign	Het
Cd300e	T	C	11: 115,054,518	N150S	probably benign	Het
Clcn1	C	A	6: 42,294,145	T281K	probably damaging	Het
Cnnm3	T	C	1: 36,518,957	S417P	probably damaging	Het
Cspg4	T	A	9: 56,897,492	S1862R	probably benign	Het
Cspg5	A	T	9: 110,262,138	N432Y	probably damaging	Het
Cyp2r1	T	A	7: 114,553,216	I169F	probably damaging	Het
D130043K22Rik	T	A	13: 24,875,999	S618T	probably damaging	Het
Diaph3	G	A	14: 86,965,549	P635L	probably damaging	Het
Dlg1	A	G	16: 31,665,667	I38V	possibly damaging	Het
Dlk1	T	G	12: 109,459,759	V186G	probably damaging	Het
Dmxl2	T	C	9: 54,423,224		probably benign	Het
Dnajc17	G	A	2: 119,183,683	R132*	probably null	Het
Dock9	G	T	14: 121,609,798	N1042K	probably benign	Het
Dok7	A	T	5: 35,086,650	Q511L	probably damaging	Het
Espnl	G	A	1: 91,344,603	E562K	possibly damaging	Het
Evi5	G	A	5: 107,795,841	T562I	probably benign	Het
Exd2	T	A	12: 80,489,479	D294E	probably benign	Het
Fbn1	A	T	2: 125,403,228	D246E	possibly damaging	Het
Fbxw16	A	T	9: 109,439,582	W247R	possibly damaging	Het
Fcer1a	A	G	1: 173,225,437	I64T	probably benign	Het
Fcgbp	C	A	7: 28,105,175	Q1903K	possibly damaging	Het
Fmn1	A	G	2: 113,365,355	S467G	unknown	Het
Fndc7	T	A	3: 108,870,534	T369S	probably damaging	Het
Fnta	T	C	8: 26,000,966		probably benign	Het
Gak	A	T	5: 108,606,892	H289Q	probably damaging	Het
Gas2l3	A	G	10: 89,417,014		probably benign	Het
Gbp8	T	C	5: 105,016,121	N437S	probably benign	Het
Gk5	G	A	9: 96,150,797		probably null	Het
Gm21818	T	A	13: 120,173,189	D2E	probably benign	Het
Hid1	A	T	11: 115,348,473	V788E	probably damaging	Het
Hmcn1	T	C	1: 150,563,568	T5505A	probably damaging	Het
Katnal2	G	A	18: 77,002,537	T258I	probably damaging	Het
Kdm3b	A	T	18: 34,803,504	I280L	probably benign	Het
Kif24	A	G	4: 41,409,787	V382A	probably damaging	Het
Kif2a	A	T	13: 106,978,132		probably benign	Het
Klhl10	A	G	11: 100,442,196	I56V	probably benign	Het
Klk6	C	T	7: 43,829,271	Q201*	probably null	Het
Klra3	A	T	6: 130,323,708	S233T	probably benign	Het
Krt9	A	T	11: 100,191,305	M223K	probably damaging	Het
Lama4	G	A	10: 39,060,224	E632K	probably benign	Het
Lamb1	T	C	12: 31,278,525	Y163H	probably damaging	Het
Lipo1	A	G	19: 33,787,421	I11T	probably benign	Het
Lix1l	T	A	3: 96,623,891	H333Q	possibly damaging	Het
Mal2	T	A	15: 54,588,387	M68K	probably damaging	Het
Map2k2	T	C	10: 81,121,100	I104T	probably damaging	Het
Matn2	T	C	15: 34,428,785	V765A	probably damaging	Het
Mptx2	T	A	1: 173,274,473	K216N	probably damaging	Het
Mup5	C	T	4: 61,832,341		probably null	Het
Mycbp2	A	G	14: 103,182,419	Y2494H	probably damaging	Het
Myh3	G	A	11: 67,099,394	D1622N	probably benign	Het
Myo6	T	C	9: 80,270,049	I609T	possibly damaging	Het
Ndst1	G	A	18: 60,702,837	T458I	probably damaging	Het
Neb	A	T	2: 52,235,677	Y3622N	probably damaging	Het
Ntm	A	G	9: 29,179,100	Y108H	probably benign	Het
Olfr273	T	G	4: 52,855,730	K261T	probably benign	Het
Olfr43	T	C	11: 74,206,572	I215V	probably benign	Het
Olfr596	T	C	7: 103,310,242	Y174H	possibly damaging	Het
Pappa2	T	A	1: 158,814,368	I1373F	possibly damaging	Het
Pear1	A	G	3: 87,754,492		probably benign	Het
Phc3	C	T	3: 30,961,820	A81T	probably damaging	Het
Pmepa1	A	G	2: 173,234,360	S105P	probably damaging	Het
Ppp6r1	T	C	7: 4,642,031	I248V	probably benign	Het
Prdm4	G	A	10: 85,893,392	T717I	probably damaging	Het
Prom1	T	C	5: 44,011,224	T669A	probably benign	Het
Ptpn5	T	A	7: 47,090,768	I96F	probably benign	Het
Ptpro	T	C	6: 137,430,743	L922P	probably damaging	Het
Reck	A	T	4: 43,890,982	H40L	probably benign	Het
Rreb1	T	A	13: 37,930,923	C753S	probably benign	Het
Sacs	T	C	14: 61,210,897	L3464P	probably damaging	Het
Samsn1	A	T	16: 75,870,775	D304E	probably benign	Het
Scgb2b3	T	C	7: 31,360,196	N51S	possibly damaging	Het
Shroom3	T	C	5: 92,940,656	S341P	probably damaging	Het
Siglece	T	C	7: 43,659,293	D212G	probably damaging	Het
Sirpa	A	G	2: 129,616,456	T331A	probably damaging	Het
Spata21	T	C	4: 141,111,296	S553P	possibly damaging	Het
Speer4b	T	A	5: 27,500,238		probably benign	Het
Srgap2	T	C	1: 131,319,638	D552G	probably damaging	Het
Stab2	A	G	10: 86,954,234	I556T	probably benign	Het
Strip1	C	T	3: 107,626,731		probably null	Het
Stxbp6	T	A	12: 44,902,870	D92V	probably damaging	Het
Styx	A	G	14: 45,356,758	K46E	probably damaging	Het
Supt20	T	A	3: 54,710,420	V314E	probably damaging	Het
Syne2	T	A	12: 75,938,729	D1650E	probably benign	Het
Szt2	T	A	4: 118,405,517	K21M	probably damaging	Het
Tbx4	A	T	11: 85,911,207	H222L	probably damaging	Het
Tmx3	A	T	18: 90,532,997	I254L	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpv2	A	T	11: 62,594,226		probably benign	Het
Ubap2	A	G	4: 41,202,380	S683P	probably benign	Het
Ube2d3	C	T	3: 135,465,211	R139W	probably benign	Het
Ubox5	G	T	2: 130,591,874	Q518K	probably benign	Het
Usp42	T	C	5: 143,717,102	N588S	probably damaging	Het
Vars2	G	A	17: 35,660,084	T618M	probably damaging	Het
Wfdc17	A	T	11: 83,704,904	N65Y	probably damaging	Het
Zbtb38	G	A	9: 96,688,041	P330L	probably damaging	Het
Zfp385a	C	T	15: 103,315,881		probably null	Het
Zfp637	T	A	6: 117,845,412	L167H	probably damaging	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	68190023	missense	probably benign
IGL00837:Igf1r	APN	7	68201352	splice site	probably benign
IGL01515:Igf1r	APN	7	68207452	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	68193441	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	68189958	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	68193396	missense	probably benign
IGL02672:Igf1r	APN	7	68190033	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	68201249	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	68189991	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	68215043	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	68214940	missense	probably damaging	1.00
Frufru	UTSW	7	68004163	missense	probably damaging	1.00
Hungarian	UTSW	7	68214997	missense	probably damaging	1.00
Mimi	UTSW	7	68195026	missense	possibly damaging	0.67
Piroshka	UTSW	7	68207336	nonsense	probably null
Romanian	UTSW	7	68004137	missense	possibly damaging	0.94
Sublime	UTSW	7	68004179	missense	probably damaging	1.00
Toy	UTSW	7	68003972	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	68226186	small insertion	probably benign
FR4737:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226186	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	68207463	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	68165242	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	68226193	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	68207826	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	68165155	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	68212158	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	68212091	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	68195026	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	68165127	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	68218468	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	68003837	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	68207869	missense	probably benign
R1745:Igf1r	UTSW	7	68169913	missense	probably damaging	1.00
R1789:Igf1r	UTSW	7	68214933	nonsense	probably null
R1823:Igf1r	UTSW	7	68194981	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	68201249	missense	possibly damaging	0.93
R1962:Igf1r	UTSW	7	68207275	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	68003950	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	68165234	missense	probably benign
R2221:Igf1r	UTSW	7	68201962	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	68183399	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	68190062	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	68195078	nonsense	probably null
R4387:Igf1r	UTSW	7	68170009	missense	probably benign
R4388:Igf1r	UTSW	7	68170009	missense	probably benign
R4728:Igf1r	UTSW	7	68189624	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	68165199	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	68207319	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	68193418	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	68193359	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	68183510	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	68207821	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	68190033	missense	probably benign
R6189:Igf1r	UTSW	7	68207336	nonsense	probably null
R6262:Igf1r	UTSW	7	68003972	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	68004137	missense	possibly damaging	0.94
R6318:Igf1r	UTSW	7	68165233	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	68190050	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	68201250	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	68207319	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	68004179	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	68004163	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	68187157	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	68195078	nonsense	probably null
R7442:Igf1r	UTSW	7	68173278	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	68184752	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	68190101	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	68187048	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	68195629	missense	probably benign
R8539:Igf1r	UTSW	7	68003848	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	68170054	splice site	probably benign
R8746:Igf1r	UTSW	7	68214997	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	68183463	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	68183438	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	68212027	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	68194998	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	68214934	missense	probably damaging	1.00
R9727:Igf1r	UTSW	7	68207806	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	68189675	missense	probably damaging	1.00
R9779:Igf1r	UTSW	7	68004317	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF032:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF034:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF037:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF039:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF044:Igf1r	UTSW	7	68226179	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226168	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226174	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226180	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226182	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226170	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226173	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAACTCCTACAAGGTCCCCTGTC -3'
(R):5'- GCTCCATGCACCCAAGTTACTACTC -3'

Sequencing Primer
(F):5'- GTTCTCAAGTTAGCACACCG -3'
(R):5'- CTACTCAATAAAGATGGCGTTGC -3'

Posted On

2014-05-23