Incidental Mutation 'R1772:Map2k2'
ID 196717
Institutional Source Beutler Lab
Gene Symbol Map2k2
Ensembl Gene ENSMUSG00000035027
Gene Name mitogen-activated protein kinase kinase 2
Synonyms MEK2, Prkmk2, MAP kinase/Erk kinase
MMRRC Submission 039803-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1772 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 80941749-80960531 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80956934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 104 (I104T)
Ref Sequence ENSEMBL: ENSMUSP00000151784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048223] [ENSMUST00000105331] [ENSMUST00000136743] [ENSMUST00000143517] [ENSMUST00000220329]
AlphaFold Q63932
Predicted Effect probably benign
Transcript: ENSMUST00000048223
SMART Domains Protein: ENSMUSP00000137918
Gene: ENSMUSG00000035027

DomainStartEndE-ValueType
low complexity region 36 52 N/A INTRINSIC
Pfam:Pkinase_Tyr 72 191 1.2e-10 PFAM
Pfam:Pkinase 72 196 5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105331
AA Change: I325T

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100968
Gene: ENSMUSG00000035027
AA Change: I325T

DomainStartEndE-ValueType
low complexity region 36 52 N/A INTRINSIC
S_TKc 72 369 8.75e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128937
Predicted Effect probably benign
Transcript: ENSMUST00000136743
SMART Domains Protein: ENSMUSP00000117567
Gene: ENSMUSG00000035027

DomainStartEndE-ValueType
Pfam:Pkinase 1 85 5.8e-14 PFAM
Pfam:Pkinase_Tyr 1 85 6.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143517
AA Change: I326T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121111
Gene: ENSMUSG00000035027
AA Change: I326T

DomainStartEndE-ValueType
low complexity region 36 52 N/A INTRINSIC
S_TKc 72 370 1.24e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220329
AA Change: I104T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.8000 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is known to play a critical role in mitogen growth factor signal transduction. It phosphorylates and thus activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, mental retardation, and distinctive facial features similar to those found in Noonan syndrome. The inhibition or degradation of this kinase is also found to be involved in the pathogenesis of Yersinia and anthrax. A pseudogene, which is located on chromosome 7, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are viable, fertile, and apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,258,465 (GRCm39) probably benign Het
Aldh1a7 T C 19: 20,693,383 (GRCm39) K179E probably damaging Het
Angptl7 G A 4: 148,581,883 (GRCm39) R168C probably damaging Het
Atp8b1 T A 18: 64,706,563 (GRCm39) I208F possibly damaging Het
Bco1 A G 8: 117,857,347 (GRCm39) Y438C probably benign Het
Bltp1 T C 3: 37,013,581 (GRCm39) S1937P probably damaging Het
Btrc A C 19: 45,501,100 (GRCm39) K218Q probably damaging Het
Cct8l1 G A 5: 25,722,697 (GRCm39) V471M probably damaging Het
Cd180 C T 13: 102,842,750 (GRCm39) L599F probably benign Het
Cd300e T C 11: 114,945,344 (GRCm39) N150S probably benign Het
Clcn1 C A 6: 42,271,079 (GRCm39) T281K probably damaging Het
Cnnm3 T C 1: 36,558,038 (GRCm39) S417P probably damaging Het
Cspg4 T A 9: 56,804,776 (GRCm39) S1862R probably benign Het
Cspg5 A T 9: 110,091,206 (GRCm39) N432Y probably damaging Het
Cyp2r1 T A 7: 114,152,451 (GRCm39) I169F probably damaging Het
D130043K22Rik T A 13: 25,059,982 (GRCm39) S618T probably damaging Het
Diaph3 G A 14: 87,202,985 (GRCm39) P635L probably damaging Het
Dlg1 A G 16: 31,484,485 (GRCm39) I38V possibly damaging Het
Dlk1 T G 12: 109,425,685 (GRCm39) V186G probably damaging Het
Dmxl2 T C 9: 54,330,508 (GRCm39) probably benign Het
Dnajc17 G A 2: 119,014,164 (GRCm39) R132* probably null Het
Dock9 G T 14: 121,847,210 (GRCm39) N1042K probably benign Het
Dok7 A T 5: 35,243,994 (GRCm39) Q511L probably damaging Het
Espnl G A 1: 91,272,325 (GRCm39) E562K possibly damaging Het
Evi5 G A 5: 107,943,707 (GRCm39) T562I probably benign Het
Exd2 T A 12: 80,536,253 (GRCm39) D294E probably benign Het
Fbn1 A T 2: 125,245,148 (GRCm39) D246E possibly damaging Het
Fbxw16 A T 9: 109,268,650 (GRCm39) W247R possibly damaging Het
Fcer1a A G 1: 173,053,004 (GRCm39) I64T probably benign Het
Fcgbp C A 7: 27,804,600 (GRCm39) Q1903K possibly damaging Het
Fmn1 A G 2: 113,195,700 (GRCm39) S467G unknown Het
Fndc7 T A 3: 108,777,850 (GRCm39) T369S probably damaging Het
Fnta T C 8: 26,490,994 (GRCm39) probably benign Het
Gak A T 5: 108,754,758 (GRCm39) H289Q probably damaging Het
Gas2l3 A G 10: 89,252,876 (GRCm39) probably benign Het
Gbp8 T C 5: 105,163,987 (GRCm39) N437S probably benign Het
Gk5 G A 9: 96,032,850 (GRCm39) probably null Het
Hid1 A T 11: 115,239,299 (GRCm39) V788E probably damaging Het
Hmcn1 T C 1: 150,439,319 (GRCm39) T5505A probably damaging Het
Igf1r T A 7: 67,844,822 (GRCm39) M865K probably benign Het
Katnal2 G A 18: 77,090,233 (GRCm39) T258I probably damaging Het
Kdm3b A T 18: 34,936,557 (GRCm39) I280L probably benign Het
Kif24 A G 4: 41,409,787 (GRCm39) V382A probably damaging Het
Kif2a A T 13: 107,114,640 (GRCm39) probably benign Het
Klhl10 A G 11: 100,333,022 (GRCm39) I56V probably benign Het
Klk6 C T 7: 43,478,695 (GRCm39) Q201* probably null Het
Klra3 A T 6: 130,300,671 (GRCm39) S233T probably benign Het
Krt9 A T 11: 100,082,131 (GRCm39) M223K probably damaging Het
Lama4 G A 10: 38,936,220 (GRCm39) E632K probably benign Het
Lamb1 T C 12: 31,328,524 (GRCm39) Y163H probably damaging Het
Lipo3 A G 19: 33,764,821 (GRCm39) I11T probably benign Het
Lix1l T A 3: 96,531,207 (GRCm39) H333Q possibly damaging Het
Mal2 T A 15: 54,451,783 (GRCm39) M68K probably damaging Het
Matn2 T C 15: 34,428,931 (GRCm39) V765A probably damaging Het
Mptx2 T A 1: 173,102,040 (GRCm39) K216N probably damaging Het
Mup5 C T 4: 61,750,578 (GRCm39) probably null Het
Mycbp2 A G 14: 103,419,855 (GRCm39) Y2494H probably damaging Het
Myh3 G A 11: 66,990,220 (GRCm39) D1622N probably benign Het
Myo6 T C 9: 80,177,331 (GRCm39) I609T possibly damaging Het
Ndst1 G A 18: 60,835,909 (GRCm39) T458I probably damaging Het
Neb A T 2: 52,125,689 (GRCm39) Y3622N probably damaging Het
Ntm A G 9: 29,090,396 (GRCm39) Y108H probably benign Het
Or13c3 T G 4: 52,855,730 (GRCm39) K261T probably benign Het
Or1a1b T C 11: 74,097,398 (GRCm39) I215V probably benign Het
Or52e19 T C 7: 102,959,449 (GRCm39) Y174H possibly damaging Het
Pappa2 T A 1: 158,641,938 (GRCm39) I1373F possibly damaging Het
Pear1 A G 3: 87,661,799 (GRCm39) probably benign Het
Phc3 C T 3: 31,015,969 (GRCm39) A81T probably damaging Het
Pmepa1 A G 2: 173,076,153 (GRCm39) S105P probably damaging Het
Ppp6r1 T C 7: 4,645,030 (GRCm39) I248V probably benign Het
Prdm4 G A 10: 85,729,256 (GRCm39) T717I probably damaging Het
Prom1 T C 5: 44,168,566 (GRCm39) T669A probably benign Het
Ptpn5 T A 7: 46,740,516 (GRCm39) I96F probably benign Het
Ptpro T C 6: 137,407,741 (GRCm39) L922P probably damaging Het
Reck A T 4: 43,890,982 (GRCm39) H40L probably benign Het
Rreb1 T A 13: 38,114,899 (GRCm39) C753S probably benign Het
Sacs T C 14: 61,448,346 (GRCm39) L3464P probably damaging Het
Samsn1 A T 16: 75,667,663 (GRCm39) D304E probably benign Het
Scgb2b3 T C 7: 31,059,621 (GRCm39) N51S possibly damaging Het
Shroom3 T C 5: 93,088,515 (GRCm39) S341P probably damaging Het
Siglece T C 7: 43,308,717 (GRCm39) D212G probably damaging Het
Sirpa A G 2: 129,458,376 (GRCm39) T331A probably damaging Het
Spata21 T C 4: 140,838,607 (GRCm39) S553P possibly damaging Het
Speer4b T A 5: 27,705,236 (GRCm39) probably benign Het
Srgap2 T C 1: 131,247,376 (GRCm39) D552G probably damaging Het
Stab2 A G 10: 86,790,098 (GRCm39) I556T probably benign Het
Strip1 C T 3: 107,534,047 (GRCm39) probably null Het
Stxbp6 T A 12: 44,949,653 (GRCm39) D92V probably damaging Het
Styx A G 14: 45,594,215 (GRCm39) K46E probably damaging Het
Supt20 T A 3: 54,617,841 (GRCm39) V314E probably damaging Het
Syne2 T A 12: 75,985,503 (GRCm39) D1650E probably benign Het
Szt2 T A 4: 118,262,714 (GRCm39) K21M probably damaging Het
Tbx4 A T 11: 85,802,033 (GRCm39) H222L probably damaging Het
Tcstv1b T A 13: 120,634,725 (GRCm39) D2E probably benign Het
Tmx3 A T 18: 90,551,121 (GRCm39) I254L probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpv2 A T 11: 62,485,052 (GRCm39) probably benign Het
Ubap2 A G 4: 41,202,380 (GRCm39) S683P probably benign Het
Ube2d3 C T 3: 135,170,972 (GRCm39) R139W probably benign Het
Ubox5 G T 2: 130,433,794 (GRCm39) Q518K probably benign Het
Usp42 T C 5: 143,702,857 (GRCm39) N588S probably damaging Het
Vars2 G A 17: 35,970,976 (GRCm39) T618M probably damaging Het
Wfdc17 A T 11: 83,595,730 (GRCm39) N65Y probably damaging Het
Zbtb38 G A 9: 96,570,094 (GRCm39) P330L probably damaging Het
Zfp385a C T 15: 103,224,308 (GRCm39) probably null Het
Zfp637 T A 6: 117,822,373 (GRCm39) L167H probably damaging Het
Other mutations in Map2k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Map2k2 APN 10 80,956,907 (GRCm39) missense probably damaging 0.99
IGL00825:Map2k2 APN 10 80,954,052 (GRCm39) missense probably benign 0.12
IGL00826:Map2k2 APN 10 80,954,052 (GRCm39) missense probably benign 0.12
R0972:Map2k2 UTSW 10 80,955,482 (GRCm39) missense probably benign 0.00
R2202:Map2k2 UTSW 10 80,955,213 (GRCm39) missense probably damaging 0.98
R2203:Map2k2 UTSW 10 80,955,213 (GRCm39) missense probably damaging 0.98
R4010:Map2k2 UTSW 10 80,944,769 (GRCm39) missense probably damaging 1.00
R4876:Map2k2 UTSW 10 80,950,947 (GRCm39) missense probably damaging 1.00
R6905:Map2k2 UTSW 10 80,944,701 (GRCm39) missense probably damaging 1.00
R7073:Map2k2 UTSW 10 80,942,017 (GRCm39) missense probably benign
R7741:Map2k2 UTSW 10 80,956,877 (GRCm39) missense probably benign
R7832:Map2k2 UTSW 10 80,954,040 (GRCm39) missense possibly damaging 0.80
R7960:Map2k2 UTSW 10 80,954,968 (GRCm39) missense probably benign 0.09
R8052:Map2k2 UTSW 10 80,950,900 (GRCm39) missense probably damaging 1.00
R8172:Map2k2 UTSW 10 80,959,442 (GRCm39) splice site probably null
R8544:Map2k2 UTSW 10 80,955,376 (GRCm39) missense possibly damaging 0.94
R8851:Map2k2 UTSW 10 80,955,097 (GRCm39) missense probably damaging 1.00
R9021:Map2k2 UTSW 10 80,955,159 (GRCm39) missense probably damaging 0.98
R9047:Map2k2 UTSW 10 80,955,498 (GRCm39) missense probably benign
R9224:Map2k2 UTSW 10 80,954,008 (GRCm39) missense possibly damaging 0.74
R9226:Map2k2 UTSW 10 80,955,193 (GRCm39) missense possibly damaging 0.93
RF004:Map2k2 UTSW 10 80,951,002 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGTTCCTGCTGAGTTGCCAGTC -3'
(R):5'- GGAAGGAATTCACTCTCCCATGCC -3'

Sequencing Primer
(F):5'- GAGTTGCCAGTCCCCTCC -3'
(R):5'- cacactgacctctagctcaac -3'
Posted On 2014-05-23