Incidental Mutation 'R1772:Stab2'
ID 196719
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms FEEL-2, STAB-2
MMRRC Submission 039803-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1772 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86677062-86843889 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86790098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 556 (I556T)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect probably benign
Transcript: ENSMUST00000035288
AA Change: I556T

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: I556T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,258,465 (GRCm39) probably benign Het
Aldh1a7 T C 19: 20,693,383 (GRCm39) K179E probably damaging Het
Angptl7 G A 4: 148,581,883 (GRCm39) R168C probably damaging Het
Atp8b1 T A 18: 64,706,563 (GRCm39) I208F possibly damaging Het
Bco1 A G 8: 117,857,347 (GRCm39) Y438C probably benign Het
Bltp1 T C 3: 37,013,581 (GRCm39) S1937P probably damaging Het
Btrc A C 19: 45,501,100 (GRCm39) K218Q probably damaging Het
Cct8l1 G A 5: 25,722,697 (GRCm39) V471M probably damaging Het
Cd180 C T 13: 102,842,750 (GRCm39) L599F probably benign Het
Cd300e T C 11: 114,945,344 (GRCm39) N150S probably benign Het
Clcn1 C A 6: 42,271,079 (GRCm39) T281K probably damaging Het
Cnnm3 T C 1: 36,558,038 (GRCm39) S417P probably damaging Het
Cspg4 T A 9: 56,804,776 (GRCm39) S1862R probably benign Het
Cspg5 A T 9: 110,091,206 (GRCm39) N432Y probably damaging Het
Cyp2r1 T A 7: 114,152,451 (GRCm39) I169F probably damaging Het
D130043K22Rik T A 13: 25,059,982 (GRCm39) S618T probably damaging Het
Diaph3 G A 14: 87,202,985 (GRCm39) P635L probably damaging Het
Dlg1 A G 16: 31,484,485 (GRCm39) I38V possibly damaging Het
Dlk1 T G 12: 109,425,685 (GRCm39) V186G probably damaging Het
Dmxl2 T C 9: 54,330,508 (GRCm39) probably benign Het
Dnajc17 G A 2: 119,014,164 (GRCm39) R132* probably null Het
Dock9 G T 14: 121,847,210 (GRCm39) N1042K probably benign Het
Dok7 A T 5: 35,243,994 (GRCm39) Q511L probably damaging Het
Espnl G A 1: 91,272,325 (GRCm39) E562K possibly damaging Het
Evi5 G A 5: 107,943,707 (GRCm39) T562I probably benign Het
Exd2 T A 12: 80,536,253 (GRCm39) D294E probably benign Het
Fbn1 A T 2: 125,245,148 (GRCm39) D246E possibly damaging Het
Fbxw16 A T 9: 109,268,650 (GRCm39) W247R possibly damaging Het
Fcer1a A G 1: 173,053,004 (GRCm39) I64T probably benign Het
Fcgbp C A 7: 27,804,600 (GRCm39) Q1903K possibly damaging Het
Fmn1 A G 2: 113,195,700 (GRCm39) S467G unknown Het
Fndc7 T A 3: 108,777,850 (GRCm39) T369S probably damaging Het
Fnta T C 8: 26,490,994 (GRCm39) probably benign Het
Gak A T 5: 108,754,758 (GRCm39) H289Q probably damaging Het
Gas2l3 A G 10: 89,252,876 (GRCm39) probably benign Het
Gbp8 T C 5: 105,163,987 (GRCm39) N437S probably benign Het
Gk5 G A 9: 96,032,850 (GRCm39) probably null Het
Hid1 A T 11: 115,239,299 (GRCm39) V788E probably damaging Het
Hmcn1 T C 1: 150,439,319 (GRCm39) T5505A probably damaging Het
Igf1r T A 7: 67,844,822 (GRCm39) M865K probably benign Het
Katnal2 G A 18: 77,090,233 (GRCm39) T258I probably damaging Het
Kdm3b A T 18: 34,936,557 (GRCm39) I280L probably benign Het
Kif24 A G 4: 41,409,787 (GRCm39) V382A probably damaging Het
Kif2a A T 13: 107,114,640 (GRCm39) probably benign Het
Klhl10 A G 11: 100,333,022 (GRCm39) I56V probably benign Het
Klk6 C T 7: 43,478,695 (GRCm39) Q201* probably null Het
Klra3 A T 6: 130,300,671 (GRCm39) S233T probably benign Het
Krt9 A T 11: 100,082,131 (GRCm39) M223K probably damaging Het
Lama4 G A 10: 38,936,220 (GRCm39) E632K probably benign Het
Lamb1 T C 12: 31,328,524 (GRCm39) Y163H probably damaging Het
Lipo3 A G 19: 33,764,821 (GRCm39) I11T probably benign Het
Lix1l T A 3: 96,531,207 (GRCm39) H333Q possibly damaging Het
Mal2 T A 15: 54,451,783 (GRCm39) M68K probably damaging Het
Map2k2 T C 10: 80,956,934 (GRCm39) I104T probably damaging Het
Matn2 T C 15: 34,428,931 (GRCm39) V765A probably damaging Het
Mptx2 T A 1: 173,102,040 (GRCm39) K216N probably damaging Het
Mup5 C T 4: 61,750,578 (GRCm39) probably null Het
Mycbp2 A G 14: 103,419,855 (GRCm39) Y2494H probably damaging Het
Myh3 G A 11: 66,990,220 (GRCm39) D1622N probably benign Het
Myo6 T C 9: 80,177,331 (GRCm39) I609T possibly damaging Het
Ndst1 G A 18: 60,835,909 (GRCm39) T458I probably damaging Het
Neb A T 2: 52,125,689 (GRCm39) Y3622N probably damaging Het
Ntm A G 9: 29,090,396 (GRCm39) Y108H probably benign Het
Or13c3 T G 4: 52,855,730 (GRCm39) K261T probably benign Het
Or1a1b T C 11: 74,097,398 (GRCm39) I215V probably benign Het
Or52e19 T C 7: 102,959,449 (GRCm39) Y174H possibly damaging Het
Pappa2 T A 1: 158,641,938 (GRCm39) I1373F possibly damaging Het
Pear1 A G 3: 87,661,799 (GRCm39) probably benign Het
Phc3 C T 3: 31,015,969 (GRCm39) A81T probably damaging Het
Pmepa1 A G 2: 173,076,153 (GRCm39) S105P probably damaging Het
Ppp6r1 T C 7: 4,645,030 (GRCm39) I248V probably benign Het
Prdm4 G A 10: 85,729,256 (GRCm39) T717I probably damaging Het
Prom1 T C 5: 44,168,566 (GRCm39) T669A probably benign Het
Ptpn5 T A 7: 46,740,516 (GRCm39) I96F probably benign Het
Ptpro T C 6: 137,407,741 (GRCm39) L922P probably damaging Het
Reck A T 4: 43,890,982 (GRCm39) H40L probably benign Het
Rreb1 T A 13: 38,114,899 (GRCm39) C753S probably benign Het
Sacs T C 14: 61,448,346 (GRCm39) L3464P probably damaging Het
Samsn1 A T 16: 75,667,663 (GRCm39) D304E probably benign Het
Scgb2b3 T C 7: 31,059,621 (GRCm39) N51S possibly damaging Het
Shroom3 T C 5: 93,088,515 (GRCm39) S341P probably damaging Het
Siglece T C 7: 43,308,717 (GRCm39) D212G probably damaging Het
Sirpa A G 2: 129,458,376 (GRCm39) T331A probably damaging Het
Spata21 T C 4: 140,838,607 (GRCm39) S553P possibly damaging Het
Speer4b T A 5: 27,705,236 (GRCm39) probably benign Het
Srgap2 T C 1: 131,247,376 (GRCm39) D552G probably damaging Het
Strip1 C T 3: 107,534,047 (GRCm39) probably null Het
Stxbp6 T A 12: 44,949,653 (GRCm39) D92V probably damaging Het
Styx A G 14: 45,594,215 (GRCm39) K46E probably damaging Het
Supt20 T A 3: 54,617,841 (GRCm39) V314E probably damaging Het
Syne2 T A 12: 75,985,503 (GRCm39) D1650E probably benign Het
Szt2 T A 4: 118,262,714 (GRCm39) K21M probably damaging Het
Tbx4 A T 11: 85,802,033 (GRCm39) H222L probably damaging Het
Tcstv1b T A 13: 120,634,725 (GRCm39) D2E probably benign Het
Tmx3 A T 18: 90,551,121 (GRCm39) I254L probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpv2 A T 11: 62,485,052 (GRCm39) probably benign Het
Ubap2 A G 4: 41,202,380 (GRCm39) S683P probably benign Het
Ube2d3 C T 3: 135,170,972 (GRCm39) R139W probably benign Het
Ubox5 G T 2: 130,433,794 (GRCm39) Q518K probably benign Het
Usp42 T C 5: 143,702,857 (GRCm39) N588S probably damaging Het
Vars2 G A 17: 35,970,976 (GRCm39) T618M probably damaging Het
Wfdc17 A T 11: 83,595,730 (GRCm39) N65Y probably damaging Het
Zbtb38 G A 9: 96,570,094 (GRCm39) P330L probably damaging Het
Zfp385a C T 15: 103,224,308 (GRCm39) probably null Het
Zfp637 T A 6: 117,822,373 (GRCm39) L167H probably damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86,705,070 (GRCm39) splice site probably null
IGL00809:Stab2 APN 10 86,684,038 (GRCm39) splice site probably benign
IGL00911:Stab2 APN 10 86,805,617 (GRCm39) missense probably damaging 1.00
IGL01347:Stab2 APN 10 86,737,567 (GRCm39) splice site probably null
IGL01411:Stab2 APN 10 86,815,872 (GRCm39) splice site probably benign
IGL01503:Stab2 APN 10 86,776,477 (GRCm39) splice site probably benign
IGL01599:Stab2 APN 10 86,758,759 (GRCm39) missense probably damaging 1.00
IGL01635:Stab2 APN 10 86,816,992 (GRCm39) missense probably benign 0.04
IGL01640:Stab2 APN 10 86,790,035 (GRCm39) missense probably benign 0.09
IGL01671:Stab2 APN 10 86,805,141 (GRCm39) missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86,707,695 (GRCm39) missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86,803,514 (GRCm39) missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86,695,606 (GRCm39) splice site probably null
IGL02600:Stab2 APN 10 86,790,123 (GRCm39) missense probably damaging 1.00
IGL02666:Stab2 APN 10 86,686,766 (GRCm39) missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86,682,027 (GRCm39) splice site probably benign
IGL02709:Stab2 APN 10 86,682,029 (GRCm39) splice site probably benign
IGL02728:Stab2 APN 10 86,692,420 (GRCm39) missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86,786,133 (GRCm39) splice site probably benign
IGL02938:Stab2 APN 10 86,707,785 (GRCm39) missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86,832,667 (GRCm39) critical splice donor site probably null
IGL03238:Stab2 APN 10 86,690,985 (GRCm39) missense probably damaging 1.00
IGL03402:Stab2 APN 10 86,805,165 (GRCm39) missense probably benign 0.03
prospector UTSW 10 86,737,431 (GRCm39) splice site probably null
songbird UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
3-1:Stab2 UTSW 10 86,705,041 (GRCm39) missense probably damaging 0.96
F6893:Stab2 UTSW 10 86,691,035 (GRCm39) missense probably damaging 1.00
K7371:Stab2 UTSW 10 86,779,153 (GRCm39) critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86,703,039 (GRCm39) missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86,697,299 (GRCm39) nonsense probably null
R0015:Stab2 UTSW 10 86,679,481 (GRCm39) missense probably benign
R0254:Stab2 UTSW 10 86,733,824 (GRCm39) missense probably benign
R0310:Stab2 UTSW 10 86,803,477 (GRCm39) splice site probably benign
R0333:Stab2 UTSW 10 86,677,491 (GRCm39) missense probably benign
R0391:Stab2 UTSW 10 86,783,008 (GRCm39) missense probably benign 0.27
R0400:Stab2 UTSW 10 86,708,474 (GRCm39) missense probably damaging 1.00
R0433:Stab2 UTSW 10 86,679,355 (GRCm39) splice site probably benign
R0440:Stab2 UTSW 10 86,785,792 (GRCm39) missense probably benign 0.23
R0743:Stab2 UTSW 10 86,723,759 (GRCm39) missense probably damaging 1.00
R0847:Stab2 UTSW 10 86,805,735 (GRCm39) missense probably benign 0.00
R0883:Stab2 UTSW 10 86,760,314 (GRCm39) splice site probably benign
R1078:Stab2 UTSW 10 86,742,997 (GRCm39) splice site probably null
R1118:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1119:Stab2 UTSW 10 86,695,619 (GRCm39) missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86,786,165 (GRCm39) missense probably damaging 0.98
R1440:Stab2 UTSW 10 86,697,231 (GRCm39) splice site probably null
R1550:Stab2 UTSW 10 86,714,790 (GRCm39) missense probably benign 0.01
R1616:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1728:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1768:Stab2 UTSW 10 86,838,872 (GRCm39) missense probably damaging 1.00
R1776:Stab2 UTSW 10 86,793,680 (GRCm39) missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1892:Stab2 UTSW 10 86,773,913 (GRCm39) missense probably damaging 0.99
R1957:Stab2 UTSW 10 86,697,334 (GRCm39) missense probably benign 0.13
R1972:Stab2 UTSW 10 86,796,180 (GRCm39) missense probably damaging 0.99
R1975:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1976:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1996:Stab2 UTSW 10 86,838,895 (GRCm39) missense probably damaging 1.00
R2085:Stab2 UTSW 10 86,790,023 (GRCm39) missense probably damaging 1.00
R2149:Stab2 UTSW 10 86,700,904 (GRCm39) nonsense probably null
R2169:Stab2 UTSW 10 86,723,726 (GRCm39) missense probably damaging 1.00
R2201:Stab2 UTSW 10 86,776,503 (GRCm39) missense probably benign 0.22
R2296:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86,805,183 (GRCm39) missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86,770,704 (GRCm39) splice site probably benign
R2696:Stab2 UTSW 10 86,697,363 (GRCm39) missense probably benign 0.45
R2883:Stab2 UTSW 10 86,803,550 (GRCm39) missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86,697,325 (GRCm39) missense probably damaging 1.00
R3711:Stab2 UTSW 10 86,702,572 (GRCm39) missense probably damaging 1.00
R3787:Stab2 UTSW 10 86,805,141 (GRCm39) missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86,785,776 (GRCm39) missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86,714,750 (GRCm39) missense probably damaging 0.97
R3979:Stab2 UTSW 10 86,699,320 (GRCm39) missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86,693,988 (GRCm39) missense probably damaging 1.00
R4088:Stab2 UTSW 10 86,758,049 (GRCm39) missense probably damaging 1.00
R4151:Stab2 UTSW 10 86,838,847 (GRCm39) missense probably benign 0.12
R4190:Stab2 UTSW 10 86,714,808 (GRCm39) missense probably damaging 0.98
R4556:Stab2 UTSW 10 86,803,543 (GRCm39) missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86,743,235 (GRCm39) nonsense probably null
R4825:Stab2 UTSW 10 86,783,011 (GRCm39) missense probably benign 0.08
R4865:Stab2 UTSW 10 86,679,364 (GRCm39) splice site probably null
R4871:Stab2 UTSW 10 86,778,099 (GRCm39) missense probably damaging 0.99
R4943:Stab2 UTSW 10 86,790,026 (GRCm39) missense probably damaging 0.99
R4981:Stab2 UTSW 10 86,796,087 (GRCm39) missense probably benign
R4994:Stab2 UTSW 10 86,785,771 (GRCm39) missense probably benign
R4999:Stab2 UTSW 10 86,773,773 (GRCm39) missense probably damaging 0.97
R5061:Stab2 UTSW 10 86,743,249 (GRCm39) missense probably damaging 1.00
R5072:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5073:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5074:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5134:Stab2 UTSW 10 86,707,674 (GRCm39) splice site probably null
R5213:Stab2 UTSW 10 86,743,061 (GRCm39) missense probably damaging 0.99
R5508:Stab2 UTSW 10 86,796,143 (GRCm39) missense probably benign 0.01
R5530:Stab2 UTSW 10 86,783,026 (GRCm39) missense probably benign 0.04
R5540:Stab2 UTSW 10 86,683,989 (GRCm39) missense probably benign 0.30
R5839:Stab2 UTSW 10 86,708,555 (GRCm39) missense probably damaging 0.97
R5949:Stab2 UTSW 10 86,805,713 (GRCm39) missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86,773,906 (GRCm39) missense probably damaging 0.99
R6019:Stab2 UTSW 10 86,838,886 (GRCm39) missense probably benign 0.00
R6116:Stab2 UTSW 10 86,743,054 (GRCm39) missense probably damaging 1.00
R6131:Stab2 UTSW 10 86,719,642 (GRCm39) splice site probably null
R6209:Stab2 UTSW 10 86,758,867 (GRCm39) missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86,743,025 (GRCm39) missense probably damaging 1.00
R6433:Stab2 UTSW 10 86,737,431 (GRCm39) splice site probably null
R6787:Stab2 UTSW 10 86,754,948 (GRCm39) missense probably benign 0.07
R6841:Stab2 UTSW 10 86,778,054 (GRCm39) missense probably damaging 1.00
R6873:Stab2 UTSW 10 86,697,230 (GRCm39) critical splice donor site probably null
R7025:Stab2 UTSW 10 86,686,701 (GRCm39) missense probably damaging 1.00
R7043:Stab2 UTSW 10 86,706,110 (GRCm39) missense probably damaging 0.99
R7047:Stab2 UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
R7107:Stab2 UTSW 10 86,741,456 (GRCm39) missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86,735,705 (GRCm39) missense probably damaging 0.99
R7271:Stab2 UTSW 10 86,838,972 (GRCm39) splice site probably null
R7291:Stab2 UTSW 10 86,782,084 (GRCm39) missense probably damaging 0.96
R7336:Stab2 UTSW 10 86,805,049 (GRCm39) nonsense probably null
R7432:Stab2 UTSW 10 86,721,547 (GRCm39) missense probably damaging 0.99
R7580:Stab2 UTSW 10 86,705,028 (GRCm39) missense probably benign 0.00
R7622:Stab2 UTSW 10 86,709,766 (GRCm39) missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86,719,646 (GRCm39) critical splice donor site probably null
R7658:Stab2 UTSW 10 86,816,999 (GRCm39) missense probably benign 0.12
R7798:Stab2 UTSW 10 86,793,776 (GRCm39) missense probably damaging 0.98
R7835:Stab2 UTSW 10 86,708,483 (GRCm39) missense probably benign 0.06
R7845:Stab2 UTSW 10 86,832,758 (GRCm39) missense probably benign 0.09
R7863:Stab2 UTSW 10 86,808,745 (GRCm39) missense probably benign 0.30
R7885:Stab2 UTSW 10 86,714,776 (GRCm39) missense probably benign 0.03
R7904:Stab2 UTSW 10 86,790,056 (GRCm39) nonsense probably null
R7947:Stab2 UTSW 10 86,681,897 (GRCm39) missense probably benign 0.31
R7963:Stab2 UTSW 10 86,683,887 (GRCm39) critical splice donor site probably null
R8014:Stab2 UTSW 10 86,686,767 (GRCm39) missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86,741,403 (GRCm39) missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86,681,916 (GRCm39) missense probably benign 0.34
R8097:Stab2 UTSW 10 86,704,959 (GRCm39) missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86,709,728 (GRCm39) missense probably damaging 0.98
R8462:Stab2 UTSW 10 86,803,598 (GRCm39) missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86,776,587 (GRCm39) missense probably damaging 1.00
R8692:Stab2 UTSW 10 86,808,794 (GRCm39) missense probably damaging 0.99
R8744:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8745:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8782:Stab2 UTSW 10 86,735,685 (GRCm39) missense probably benign 0.00
R8875:Stab2 UTSW 10 86,832,728 (GRCm39) missense probably damaging 1.00
R8978:Stab2 UTSW 10 86,785,782 (GRCm39) missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9248:Stab2 UTSW 10 86,727,481 (GRCm39) missense probably damaging 0.98
R9326:Stab2 UTSW 10 86,791,010 (GRCm39) missense probably damaging 1.00
R9426:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9568:Stab2 UTSW 10 86,699,420 (GRCm39) missense probably damaging 1.00
R9627:Stab2 UTSW 10 86,793,704 (GRCm39) missense probably damaging 0.98
R9635:Stab2 UTSW 10 86,686,651 (GRCm39) nonsense probably null
R9648:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9649:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9650:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9726:Stab2 UTSW 10 86,790,095 (GRCm39) missense probably benign 0.00
R9756:Stab2 UTSW 10 86,803,553 (GRCm39) missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86,757,997 (GRCm39) missense probably benign 0.03
RF061:Stab2 UTSW 10 86,702,622 (GRCm39) critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86,758,062 (GRCm39) critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86,723,680 (GRCm39) missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86,785,778 (GRCm39) missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86,732,460 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCTAAGTGACCTAATGACGG -3'
(R):5'- TCGATCATGCAGACTCACACTTTCATC -3'

Sequencing Primer
(F):5'- atctatctgtctgtctgtctgtc -3'
(R):5'- GAGGTAAGAACTCTCAAACTTTCCAG -3'
Posted On 2014-05-23