Incidental Mutation 'R0081:H1foo'
ID19672
Institutional Source Beutler Lab
Gene Symbol H1foo
Ensembl Gene ENSMUSG00000042279
Gene NameH1 histone family, member O, oocyte-specific
SynonymsH1oo
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0081 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location115944938-115950236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115949981 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 273 (E273G)
Ref Sequence ENSEMBL: ENSMUSP00000036951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511] [ENSMUST00000037831] [ENSMUST00000161617] [ENSMUST00000161969] [ENSMUST00000162084] [ENSMUST00000205177]
Predicted Effect probably benign
Transcript: ENSMUST00000015511
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037831
AA Change: E273G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036951
Gene: ENSMUSG00000042279
AA Change: E273G

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
H15 43 110 8.84e-11 SMART
low complexity region 123 146 N/A INTRINSIC
low complexity region 182 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161617
SMART Domains Protein: ENSMUSP00000125701
Gene: ENSMUSG00000042279

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
H15 43 110 8.84e-11 SMART
low complexity region 123 146 N/A INTRINSIC
low complexity region 182 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161969
SMART Domains Protein: ENSMUSP00000123797
Gene: ENSMUSG00000042279

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
H15 43 110 8.84e-11 SMART
low complexity region 123 146 N/A INTRINSIC
low complexity region 182 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162084
Predicted Effect probably benign
Transcript: ENSMUST00000205177
SMART Domains Protein: ENSMUSP00000144958
Gene: ENSMUSG00000042279

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. The protein encoded is a replication-independent histone that is a member of the histone H1 family. This gene contains introns, unlike most histone genes and the encoded protein is expressed only in oocytes. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit no detectable abnormalities. Oocytes develop normally and no defects in fertility or litter sizes are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Ddx41 A T 13: 55,535,380 H171Q possibly damaging Het
Dennd5b G T 6: 148,993,759 Q1258K probably benign Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Foxp2 T C 6: 15,405,644 probably benign Het
Frmd4a T C 2: 4,572,441 probably null Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Hk2 A T 6: 82,734,976 probably benign Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Il10ra T G 9: 45,255,949 M435L probably benign Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr344 T A 2: 36,568,881 Y94* probably null Het
Olfr352 T C 2: 36,870,010 L148S possibly damaging Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in H1foo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:H1foo APN 6 115947627 unclassified probably benign
IGL00864:H1foo APN 6 115948626 missense probably damaging 0.99
R0050:H1foo UTSW 6 115947768 missense probably damaging 1.00
R0050:H1foo UTSW 6 115947768 missense probably damaging 1.00
R0056:H1foo UTSW 6 115946973 unclassified probably benign
R0559:H1foo UTSW 6 115947799 missense probably damaging 1.00
R1302:H1foo UTSW 6 115947649 nonsense probably null
R1476:H1foo UTSW 6 115947740 missense possibly damaging 0.61
R1824:H1foo UTSW 6 115948758 missense probably null 0.97
R3778:H1foo UTSW 6 115949747 critical splice donor site probably null
R3928:H1foo UTSW 6 115948796 missense probably benign 0.12
R3929:H1foo UTSW 6 115948796 missense probably benign 0.12
R6316:H1foo UTSW 6 115948915 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGAGCCTGTAGACCCTTTGTCCC -3'
(R):5'- CAGTCCAGTGTCCAATGTACCAGTG -3'

Sequencing Primer
(F):5'- ctgggaaggaagcctgtg -3'
(R):5'- GTCCAATGTACCAGTGTGTGAATAC -3'
Posted On2013-04-11