Incidental Mutation 'R1773:Pikfyve'
ID 196766
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission 039804-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1773 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65231430 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 100 (L100P)
Ref Sequence ENSEMBL: ENSMUSP00000079926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000185263] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect probably damaging
Transcript: ENSMUST00000081154
AA Change: L100P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: L100P

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097707
AA Change: L100P

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: L100P

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187579
Predicted Effect probably damaging
Transcript: ENSMUST00000190058
AA Change: L100P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949
AA Change: L100P

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189925
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,280,020 (GRCm39) K334E probably damaging Het
Abca12 A G 1: 71,327,755 (GRCm39) Y1442H probably damaging Het
Acot12 A G 13: 91,905,676 (GRCm39) T79A probably benign Het
Adipoq A C 16: 22,973,988 (GRCm39) Q26P unknown Het
Afg2a T C 3: 37,493,334 (GRCm39) F515L probably damaging Het
Akap13 T A 7: 75,333,199 (GRCm39) N1582K possibly damaging Het
Alg9 A G 9: 50,690,396 (GRCm39) T133A probably benign Het
Anks3 T C 16: 4,765,158 (GRCm39) T418A probably benign Het
Ano3 A C 2: 110,591,800 (GRCm39) L37R probably damaging Het
Ano9 A G 7: 140,688,291 (GRCm39) F178L possibly damaging Het
Arhgef12 A G 9: 42,916,838 (GRCm39) probably null Het
Arl16 T A 11: 120,356,589 (GRCm39) I137F possibly damaging Het
Brpf1 T A 6: 113,296,892 (GRCm39) S959T possibly damaging Het
Ccdc27 C T 4: 154,126,222 (GRCm39) R89Q unknown Het
Cd109 A C 9: 78,611,006 (GRCm39) Q1207H probably benign Het
Cd14 A T 18: 36,858,357 (GRCm39) V366D possibly damaging Het
Cep290 G A 10: 100,346,435 (GRCm39) V538I probably benign Het
Cep57 G A 9: 13,727,364 (GRCm39) A202V probably damaging Het
Chl1 T C 6: 103,624,292 (GRCm39) probably null Het
Cmah T G 13: 24,601,282 (GRCm39) F29L probably benign Het
Cracd G T 5: 77,015,052 (GRCm39) A42S possibly damaging Het
Crybg1 A G 10: 43,868,544 (GRCm39) V1378A possibly damaging Het
Cryzl2 A G 1: 157,298,292 (GRCm39) K227R probably benign Het
D130043K22Rik T G 13: 25,066,585 (GRCm39) V794G possibly damaging Het
Ddx4 T A 13: 112,736,436 (GRCm39) T645S probably benign Het
Dhcr7 C T 7: 143,401,195 (GRCm39) R453C possibly damaging Het
Dhx8 T C 11: 101,643,189 (GRCm39) Y754H possibly damaging Het
Dip2b T A 15: 100,091,842 (GRCm39) D860E probably benign Het
Dnah7a T C 1: 53,472,046 (GRCm39) probably null Het
Dst A G 1: 34,330,980 (GRCm39) D6937G probably damaging Het
Dusp1 A G 17: 26,726,081 (GRCm39) I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 (GRCm39) Q1859L probably damaging Het
E4f1 C A 17: 24,665,558 (GRCm39) G328V probably damaging Het
Eml5 T C 12: 98,765,098 (GRCm39) Y1617C probably damaging Het
Espn G T 4: 152,212,686 (GRCm39) P622Q probably damaging Het
Fam184b G A 5: 45,741,676 (GRCm39) P185L possibly damaging Het
Fn1 T A 1: 71,676,542 (GRCm39) D563V probably damaging Het
Gad2 A G 2: 22,580,219 (GRCm39) Y540C probably benign Het
Garin1b T C 6: 29,334,152 (GRCm39) S335P possibly damaging Het
Gdf11 T C 10: 128,727,163 (GRCm39) D131G probably damaging Het
Gm19965 T A 1: 116,748,989 (GRCm39) Y223* probably null Het
H2-M10.6 A G 17: 37,123,076 (GRCm39) K3R probably benign Het
Hid1 A G 11: 115,239,336 (GRCm39) Y776H probably damaging Het
Hivep3 A T 4: 119,956,034 (GRCm39) K1450I probably damaging Het
Icam5 T C 9: 20,944,821 (GRCm39) L128P possibly damaging Het
Idnk T C 13: 58,305,526 (GRCm39) V9A probably damaging Het
Il4ra A T 7: 125,166,354 (GRCm39) T33S possibly damaging Het
Ino80 A G 2: 119,248,890 (GRCm39) V990A probably benign Het
Krtap4-9 T C 11: 99,676,396 (GRCm39) probably benign Het
Lrrk2 A G 15: 91,664,184 (GRCm39) I1974V possibly damaging Het
Mcm3ap C T 10: 76,306,994 (GRCm39) A369V probably benign Het
Nek6 A G 2: 38,472,431 (GRCm39) M252V probably benign Het
Nfasc T A 1: 132,538,577 (GRCm39) I443F probably damaging Het
Nme8 T G 13: 19,881,206 (GRCm39) M1L probably damaging Het
Npnt T A 3: 132,610,454 (GRCm39) Q423L possibly damaging Het
Nup133 A T 8: 124,657,722 (GRCm39) C404* probably null Het
Or2b7 T C 13: 21,739,982 (GRCm39) D70G probably damaging Het
Or4c124 A G 2: 89,156,086 (GRCm39) V146A probably benign Het
Or4f14b A G 2: 111,775,204 (GRCm39) V199A possibly damaging Het
Or56a4 T C 7: 104,806,190 (GRCm39) E233G probably benign Het
Or5an1c T C 19: 12,219,023 (GRCm39) M1V probably null Het
Or6c213 A G 10: 129,574,312 (GRCm39) L158S probably damaging Het
Otog T A 7: 45,937,583 (GRCm39) I1764N probably benign Het
Oxa1l A G 14: 54,600,909 (GRCm39) I127M probably benign Het
P4hb C A 11: 120,463,552 (GRCm39) V28F probably damaging Het
Pbld2 C T 10: 62,890,150 (GRCm39) A186V probably benign Het
Pdzph1 G T 17: 59,281,808 (GRCm39) T158K probably damaging Het
Pgm2 T A 5: 64,265,194 (GRCm39) probably null Het
Phip A T 9: 82,758,242 (GRCm39) S1484T probably benign Het
Pla2g4e A G 2: 120,075,202 (GRCm39) S63P probably benign Het
Plekhh2 A G 17: 84,906,693 (GRCm39) E1176G probably damaging Het
Prlr T A 15: 10,325,404 (GRCm39) Y192* probably null Het
Pten T A 19: 32,775,472 (GRCm39) C71S probably damaging Het
Rbbp8nl A G 2: 179,922,987 (GRCm39) L202P probably benign Het
Ripor2 T A 13: 24,885,237 (GRCm39) S491T probably benign Het
Robo1 A T 16: 72,801,399 (GRCm39) I1008F probably benign Het
Scg2 T C 1: 79,413,352 (GRCm39) N417S probably benign Het
Scn8a A G 15: 100,937,496 (GRCm39) I1581V probably damaging Het
Slc22a8 T A 19: 8,571,593 (GRCm39) I108N probably damaging Het
Slc9a8 A T 2: 167,313,385 (GRCm39) T416S possibly damaging Het
Spata32 T A 11: 103,099,644 (GRCm39) E287V probably damaging Het
Tgfbrap1 C T 1: 43,114,512 (GRCm39) G196D probably damaging Het
Tgm5 G T 2: 120,908,131 (GRCm39) T15K possibly damaging Het
Tmc1 C T 19: 20,803,865 (GRCm39) probably null Het
Tmem177 T C 1: 119,838,306 (GRCm39) I124M possibly damaging Het
Trim30a A G 7: 104,085,108 (GRCm39) F34S probably damaging Het
Tsn T C 1: 118,232,969 (GRCm39) T112A probably benign Het
Tspyl5 T G 15: 33,686,922 (GRCm39) N341T probably benign Het
Vmn2r108 C T 17: 20,689,335 (GRCm39) C540Y probably damaging Het
Vrtn C T 12: 84,696,998 (GRCm39) R583W probably damaging Het
Wnt1 T C 15: 98,689,638 (GRCm39) S142P probably damaging Het
Wrn A T 8: 33,833,589 (GRCm39) I108N probably damaging Het
Zfhx2 A C 14: 55,310,348 (GRCm39) C733G possibly damaging Het
Zfp219 T C 14: 52,244,563 (GRCm39) T539A probably damaging Het
Zswim8 T A 14: 20,761,598 (GRCm39) M177K probably damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACCTTGTTGAACTCTGAGCC -3'
(R):5'- ACTAACCTGTGCTCTCCTGAGGATG -3'

Sequencing Primer
(F):5'- GAACTCTGAGCCTTAGTTTTTCAAG -3'
(R):5'- CAAAGTGTTCTCTGCTGAAACC -3'
Posted On 2014-05-23